ID: 986289206

View in Genome Browser
Species Human (GRCh38)
Location 5:6385312-6385334
Sequence CTGCTGGTCTTGAGCAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986289206_986289208 4 Left 986289206 5:6385312-6385334 CCTTCTCTGCTCAAGACCAGCAG No data
Right 986289208 5:6385339-6385361 CGTTGTCTGTATTGTGATCGCGG No data
986289206_986289211 25 Left 986289206 5:6385312-6385334 CCTTCTCTGCTCAAGACCAGCAG No data
Right 986289211 5:6385360-6385382 GGGATGTTTAATTCAGGACCAGG No data
986289206_986289209 5 Left 986289206 5:6385312-6385334 CCTTCTCTGCTCAAGACCAGCAG No data
Right 986289209 5:6385340-6385362 GTTGTCTGTATTGTGATCGCGGG No data
986289206_986289210 19 Left 986289206 5:6385312-6385334 CCTTCTCTGCTCAAGACCAGCAG No data
Right 986289210 5:6385354-6385376 GATCGCGGGATGTTTAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986289206 Original CRISPR CTGCTGGTCTTGAGCAGAGA AGG (reversed) Intergenic
No off target data available for this crispr