ID: 986291442

View in Genome Browser
Species Human (GRCh38)
Location 5:6402603-6402625
Sequence TTAGGGACCCCGAAGCATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986291442_986291446 5 Left 986291442 5:6402603-6402625 CCATTATGCTTCGGGGTCCCTAA No data
Right 986291446 5:6402631-6402653 AGAAGGTAGAGTGTGTTGCTTGG No data
986291442_986291447 6 Left 986291442 5:6402603-6402625 CCATTATGCTTCGGGGTCCCTAA No data
Right 986291447 5:6402632-6402654 GAAGGTAGAGTGTGTTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986291442 Original CRISPR TTAGGGACCCCGAAGCATAA TGG (reversed) Intergenic
No off target data available for this crispr