ID: 986292975

View in Genome Browser
Species Human (GRCh38)
Location 5:6415200-6415222
Sequence GAAGATGCAGAGATGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986292975_986292979 3 Left 986292975 5:6415200-6415222 CCCCTCTGCATCTCTGCATCTTC No data
Right 986292979 5:6415226-6415248 CATCATAAAGACAGTCTCATTGG No data
986292975_986292980 11 Left 986292975 5:6415200-6415222 CCCCTCTGCATCTCTGCATCTTC No data
Right 986292980 5:6415234-6415256 AGACAGTCTCATTGGATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986292975 Original CRISPR GAAGATGCAGAGATGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr