ID: 986293157

View in Genome Browser
Species Human (GRCh38)
Location 5:6416486-6416508
Sequence TTTCACCTAGAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986293157_986293161 -6 Left 986293157 5:6416486-6416508 CCCTCCACCTTCTCTAGGTGAAA No data
Right 986293161 5:6416503-6416525 GTGAAAAGATGTTTTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986293157 Original CRISPR TTTCACCTAGAGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr