ID: 986293683

View in Genome Browser
Species Human (GRCh38)
Location 5:6420195-6420217
Sequence GCCTTTTCTGGCATCTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986293683_986293687 12 Left 986293683 5:6420195-6420217 CCTCTGAAGATGCCAGAAAAGGC No data
Right 986293687 5:6420230-6420252 CTCCCTCCTTGGCTTGTAGTTGG No data
986293683_986293685 1 Left 986293683 5:6420195-6420217 CCTCTGAAGATGCCAGAAAAGGC No data
Right 986293685 5:6420219-6420241 CTGTTCATGTCCTCCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986293683 Original CRISPR GCCTTTTCTGGCATCTTCAG AGG (reversed) Intergenic
No off target data available for this crispr