ID: 986294301

View in Genome Browser
Species Human (GRCh38)
Location 5:6424323-6424345
Sequence CCTTCCAAACGCATTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986294301_986294308 22 Left 986294301 5:6424323-6424345 CCAGCAGGAATGCGTTTGGAAGG No data
Right 986294308 5:6424368-6424390 GCATTCGTGCACAGCTGTGAGGG No data
986294301_986294309 23 Left 986294301 5:6424323-6424345 CCAGCAGGAATGCGTTTGGAAGG No data
Right 986294309 5:6424369-6424391 CATTCGTGCACAGCTGTGAGGGG No data
986294301_986294303 0 Left 986294301 5:6424323-6424345 CCAGCAGGAATGCGTTTGGAAGG No data
Right 986294303 5:6424346-6424368 CTGCTGTGCTCCCAAGAACCAGG No data
986294301_986294307 21 Left 986294301 5:6424323-6424345 CCAGCAGGAATGCGTTTGGAAGG No data
Right 986294307 5:6424367-6424389 GGCATTCGTGCACAGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986294301 Original CRISPR CCTTCCAAACGCATTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr