ID: 986296824

View in Genome Browser
Species Human (GRCh38)
Location 5:6446339-6446361
Sequence CAGGGGGTCCCCGCTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986296812_986296824 28 Left 986296812 5:6446288-6446310 CCAGCAATGCAGCCGGCGTGGGG No data
Right 986296824 5:6446339-6446361 CAGGGGGTCCCCGCTGGGTGTGG No data
986296815_986296824 16 Left 986296815 5:6446300-6446322 CCGGCGTGGGGCATCAGGTAGAG No data
Right 986296824 5:6446339-6446361 CAGGGGGTCCCCGCTGGGTGTGG No data
986296810_986296824 29 Left 986296810 5:6446287-6446309 CCCAGCAATGCAGCCGGCGTGGG No data
Right 986296824 5:6446339-6446361 CAGGGGGTCCCCGCTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986296824 Original CRISPR CAGGGGGTCCCCGCTGGGTG TGG Intergenic
No off target data available for this crispr