ID: 986296877

View in Genome Browser
Species Human (GRCh38)
Location 5:6446708-6446730
Sequence AGTGGGAATCTCAGCTGCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986296877_986296883 4 Left 986296877 5:6446708-6446730 CCGTCGCAGCTGAGATTCCCACT No data
Right 986296883 5:6446735-6446757 GGGCACCCACCTGAGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986296877 Original CRISPR AGTGGGAATCTCAGCTGCGA CGG (reversed) Intergenic