ID: 986296883

View in Genome Browser
Species Human (GRCh38)
Location 5:6446735-6446757
Sequence GGGCACCCACCTGAGAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986296877_986296883 4 Left 986296877 5:6446708-6446730 CCGTCGCAGCTGAGATTCCCACT No data
Right 986296883 5:6446735-6446757 GGGCACCCACCTGAGAGCACAGG No data
986296875_986296883 8 Left 986296875 5:6446704-6446726 CCTCCCGTCGCAGCTGAGATTCC No data
Right 986296883 5:6446735-6446757 GGGCACCCACCTGAGAGCACAGG No data
986296873_986296883 23 Left 986296873 5:6446689-6446711 CCAGGGCAAATAGGCCCTCCCGT No data
Right 986296883 5:6446735-6446757 GGGCACCCACCTGAGAGCACAGG No data
986296876_986296883 5 Left 986296876 5:6446707-6446729 CCCGTCGCAGCTGAGATTCCCAC No data
Right 986296883 5:6446735-6446757 GGGCACCCACCTGAGAGCACAGG No data
986296874_986296883 9 Left 986296874 5:6446703-6446725 CCCTCCCGTCGCAGCTGAGATTC No data
Right 986296883 5:6446735-6446757 GGGCACCCACCTGAGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986296883 Original CRISPR GGGCACCCACCTGAGAGCAC AGG Intergenic