ID: 986299770

View in Genome Browser
Species Human (GRCh38)
Location 5:6468690-6468712
Sequence CTCCTAAGAAGTAGAATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986299770_986299771 10 Left 986299770 5:6468690-6468712 CCTTCAATTCTACTTCTTAGGAG 0: 1
1: 0
2: 1
3: 20
4: 296
Right 986299771 5:6468723-6468745 AGTTAACTTATAGTTACTTCCGG 0: 1
1: 0
2: 1
3: 24
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986299770 Original CRISPR CTCCTAAGAAGTAGAATTGA AGG (reversed) Intronic
901095445 1:6675537-6675559 CTCCCAAGAAGTAGGATTACAGG + Intronic
904015882 1:27420246-27420268 TTCCTGAGATGTAGATTTGAAGG - Intronic
906911456 1:49955922-49955944 CTCATGAGAATTAGAATAGATGG - Intronic
908369948 1:63471749-63471771 AATCTAAGAAGTAGAATTAAGGG - Intronic
909511660 1:76459997-76460019 ATACTTAGGAGTAGAATTGATGG + Intronic
911781855 1:101889881-101889903 CTTCTGAGAAGTAGAATTATAGG - Intronic
911833138 1:102580133-102580155 ATTCTAAGAACTAGAATTTAGGG + Intergenic
911911641 1:103644839-103644861 CACCTAAGAGGTAGAACTGATGG + Intergenic
911916813 1:103707111-103707133 CACCTAAGAGGTAGAACTGATGG - Intronic
911919056 1:103738977-103738999 CACCTAAGAGGTAGAACTGATGG + Intronic
912176908 1:107170172-107170194 TTCCTAAAAAGTAGAGGTGATGG - Intronic
913218705 1:116642625-116642647 CTCACAAGAATTAAAATTGATGG + Intronic
913409711 1:118537614-118537636 CTCCTCAGAAATAGAATTTTAGG - Intergenic
916896197 1:169164801-169164823 ATCCTAAGAAGTAGAATTCTGGG + Intronic
917219136 1:172708821-172708843 CTCCTCAGCTGTAGATTTGATGG + Intergenic
917375017 1:174342716-174342738 CTTCTGAGAATTAGAATTGGTGG - Intronic
917894067 1:179469529-179469551 CACCTAAGGAGTGGAATTGCTGG + Intronic
921347465 1:214201582-214201604 ATACTCAGAAGTAGAATTGCTGG - Intergenic
921455091 1:215361473-215361495 CTTTTAAGAAGTTGAATTCATGG - Intergenic
921580783 1:216893823-216893845 CTCCTAAAAGGTACATTTGAAGG + Intronic
923831102 1:237558305-237558327 TTCCTAAGGAGTAGAAGTTAGGG + Intronic
1063132587 10:3191340-3191362 CTGCTGAGAAATAGACTTGATGG + Intergenic
1063450801 10:6148775-6148797 CTCCTTAGAAATCGAATAGATGG + Intronic
1064543790 10:16431347-16431369 CCACTAAGAAGTGGAATTGCTGG + Intergenic
1064737979 10:18402456-18402478 CACCTATGAAGTAAAATTCAGGG - Intronic
1065399988 10:25288214-25288236 CTCCTAAATAGTAGATTTGGGGG + Intronic
1065405729 10:25361446-25361468 ATACTCAGAAGTAGAATTGCAGG + Intronic
1065829694 10:29603518-29603540 CTCCCAAGAATTATAATTTATGG + Intronic
1068545497 10:58339889-58339911 CTCCTAAGAAGTGGAAGAGAAGG - Intronic
1069480484 10:68777363-68777385 CTTCTATGAAGTAAAAATGATGG - Intronic
1070291458 10:75118188-75118210 CTTCTGAGCAGTAGAATTTAGGG - Intronic
1074349340 10:112720222-112720244 CTACTTAGGAGTAGAATTGCTGG + Intronic
1074734472 10:116414401-116414423 CTCCTAAGTAGTAGAAAACAAGG - Intergenic
1075567809 10:123517569-123517591 CTCCAAAGGAGTGGAGTTGAAGG + Intergenic
1076374968 10:129977401-129977423 CTCCTGAGTAGTACAATTCATGG - Intergenic
1081152625 11:39651136-39651158 CCCCTAAGAAGGAGAATTATGGG - Intergenic
1082199317 11:49344448-49344470 CTTCTAAAAAGAAGAATTAAAGG - Intergenic
1085233107 11:74989601-74989623 CTCCTAACAAGTAATATTTAAGG - Intronic
1086435576 11:86777008-86777030 CTTCCCAGAAGTAGAATTGCTGG + Intergenic
1086656501 11:89363679-89363701 CTTCTAAAAAGAAGAATTAAAGG + Intronic
1087578358 11:100019699-100019721 ATACTCAGAAGTAGAATTGTTGG + Intronic
1087933353 11:104003458-104003480 CTCCTAGGAACTAGAGGTGAGGG + Intronic
1089185414 11:116611536-116611558 TGCCTAAGATGTAGAAATGATGG - Intergenic
1091081312 11:132671312-132671334 CTCCTAAAAAATAAAATAGAAGG + Intronic
1091168814 11:133502746-133502768 CTCCTGAGAAGCAGAATAGTGGG - Intronic
1091717341 12:2788351-2788373 TACCTAAGAAGTGGAATTGCTGG - Intergenic
1097308270 12:58092747-58092769 TTACTAATAAGTAGAATTCAGGG - Intergenic
1098826398 12:75303003-75303025 ATACTTAGAAGTAGAATTGTTGG - Intronic
1099040474 12:77646895-77646917 GTACTTAGAAGTGGAATTGATGG - Intergenic
1099294281 12:80810603-80810625 CTCCCCAGAAGCAGAATTGCTGG + Intronic
1099582647 12:84470959-84470981 CTCCAAAGAAGTTTAACTGAGGG - Intergenic
1101609396 12:106276840-106276862 CACCTAAGAACTAGCCTTGAAGG - Intronic
1102148427 12:110671829-110671851 CTCCTAAGAAGTAGGCAGGAAGG + Intronic
1106352459 13:28946359-28946381 CTGCTAAGGAGTGGGATTGAGGG + Intronic
1106799227 13:33239387-33239409 ATACTAAGAAGTAGAATTGCTGG + Intronic
1106850455 13:33784510-33784532 CTCATAAGAAAAAGAATTGAAGG - Intergenic
1108068085 13:46599358-46599380 ATACTCAGAAGTAGAATTGCTGG + Intronic
1108614095 13:52114589-52114611 CTCCTTAACAGTAGAATGGATGG - Intronic
1108638230 13:52357379-52357401 CTACTCAGAAGTAGAATTGCTGG - Intergenic
1111070767 13:83164358-83164380 ATCCATAGAAGTAGAATTGCTGG + Intergenic
1111368447 13:87283050-87283072 CTCATAAGCAGTAGAGTTCATGG - Intergenic
1112391971 13:98993374-98993396 CTGCTGTGAAGTAGATTTGAAGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114724892 14:24925654-24925676 ATCCTTAAAAGTGGAATTGATGG - Intronic
1116249461 14:42462006-42462028 CAACTAAGAAGTAGAACTAAGGG - Intergenic
1116258129 14:42584298-42584320 CTCCTAAAAAGGATAATTCATGG + Intergenic
1116803890 14:49472536-49472558 CTACTTAGAAGTAGGATTGCTGG - Intergenic
1117137590 14:52752796-52752818 CTTCTAAGAAGGAAAATTCAGGG + Intronic
1117363614 14:55002890-55002912 TCCTTAAGAAGTAGTATTGAAGG - Intronic
1117802701 14:59461661-59461683 TGCCTGAGAAGAAGAATTGAAGG - Exonic
1118597696 14:67448841-67448863 GACCTAAGAGGTAGAATTGGAGG + Intronic
1118698286 14:68407730-68407752 CACATAGGAAGTAGCATTGAAGG + Intronic
1119453605 14:74734918-74734940 CTTGTAAGAATTAGAATCGAGGG - Exonic
1121176382 14:91893799-91893821 CTCCTCAGGAGTAAAATGGAAGG + Intronic
1122359049 14:101147692-101147714 CTTCTAAGAAGTAGAAGAGGAGG - Intergenic
1122814780 14:104307065-104307087 CTCCCAGGAAGCAGAAGTGATGG + Intergenic
1123909338 15:24951182-24951204 CTGCTTAGGAGTAGAATTGTAGG + Intronic
1124842806 15:33259867-33259889 CTTCTAAGAAATAAAGTTGATGG + Intergenic
1125867074 15:43062401-43062423 CTCTTAGAAAGTAGAATTGGTGG + Intronic
1127558050 15:60107680-60107702 GTCCTAAGAAGTGGGTTTGAGGG + Intergenic
1128355655 15:66924721-66924743 ATACTAAGAAGTGGAATTGCTGG + Intergenic
1129098528 15:73235779-73235801 CTCCTTTGCAGGAGAATTGAGGG - Intronic
1129365846 15:75053891-75053913 ATCCCTAGAAGTAGAATTGCTGG - Intronic
1130203820 15:81857272-81857294 ATACTCAGAAGTAGAATTGCTGG - Intergenic
1131102795 15:89706472-89706494 CTTCTAAGAAATACTATTGATGG + Intronic
1131696029 15:94878737-94878759 CTATTATGAAATAGAATTGAAGG + Intergenic
1132364032 15:101243001-101243023 ATCCTAAAAAATAGACTTGAGGG + Intronic
1133957452 16:10457169-10457191 CTCCGAAGAAATAAAAATGATGG - Intronic
1134367639 16:13594035-13594057 TTCCTATGAAGTAGAAAAGACGG + Intergenic
1135042706 16:19130233-19130255 CTCCAAAGAAGTAGGATTACAGG - Intronic
1135223413 16:20634928-20634950 AGCCTTAGAAGTAGAATTGCTGG + Intronic
1135556268 16:23439194-23439216 CTACTCAGAAGTGGAATTGCTGG - Intronic
1135556280 16:23439342-23439364 CTACTCAGAAGTGGAATTGCTGG - Intronic
1135636564 16:24080904-24080926 CTCCTAAAAAGTAGATGAGAAGG + Intronic
1136689298 16:32017204-32017226 ATCCTAAGGAATAGAATTGCTGG - Intergenic
1136789889 16:32960742-32960764 ATCCTAAGGAATAGAATTGCTGG - Intergenic
1136879923 16:33893194-33893216 ATCCTAAGGAATAGAATTGCTGG + Intergenic
1136933624 16:34438735-34438757 ATACTAAGAAGTAAAATTTATGG - Intergenic
1136970948 16:34973079-34973101 ATACTAAGAAGTAAAATTTATGG + Intergenic
1137721455 16:50630002-50630024 ATCCTAGGAAGCAGAAATGAGGG - Intronic
1137740830 16:50771516-50771538 CTCCCTAGGAGTAGAATTGCTGG + Intronic
1138163192 16:54775468-54775490 CTCCTCAATAGTAGAGTTGAGGG + Intergenic
1140315982 16:73897449-73897471 CTCTAAAGAAATAGTATTGACGG - Intergenic
1141557883 16:84848012-84848034 CTCCTGAGAAGTAGGATTGCTGG + Intronic
1203092092 16_KI270728v1_random:1222202-1222224 ATCCTAAGGAATAGAATTGCTGG - Intergenic
1143930351 17:10416464-10416486 ATACTCAGAAGTAGAATTGTGGG + Intronic
1144522969 17:15966657-15966679 CTCCTTATAAGGAGAATGGATGG + Intronic
1145414719 17:22704974-22704996 CTTCAAAGAAGCAGAGTTGAAGG + Intergenic
1147152139 17:38523337-38523359 ATCCTAAGGAATAGAATTGCTGG - Intergenic
1147895249 17:43746376-43746398 CTCCTCAAAAGGAGACTTGAAGG + Intergenic
1148886083 17:50773919-50773941 ATCCTCACAAGTAGAATAGATGG - Intergenic
1149773808 17:59341745-59341767 CTTTTAAGAAGGAGGATTGAAGG + Intronic
1150174430 17:63035718-63035740 TGCCTAAGAAGTAGGATTGTTGG + Intronic
1153345657 18:4022925-4022947 TTCCTTAGCAGTAGAATTGGTGG + Intronic
1155525184 18:26708919-26708941 ATGCCAAGAAGTAGAATTGCTGG + Intergenic
1158028777 18:52937032-52937054 CACCAAAGGAGTAGAATTGCTGG + Intronic
1158265579 18:55657592-55657614 ATCATAAGAAGTAGACTTCATGG + Intronic
1158643591 18:59223044-59223066 CTACTAAGAAGTAGTATTTTTGG - Intronic
1158776950 18:60594166-60594188 ATCCCAGGAAGTAGAAGTGAGGG - Intergenic
1160118105 18:76100689-76100711 CGCCTTAGAAGAAGAAATGAGGG + Intergenic
1160128639 18:76204361-76204383 CTCCTAAAATGTAGAATCTATGG + Intergenic
1160139856 18:76311780-76311802 CTCCACAGAAGTCGAATTGTTGG + Intergenic
1162642119 19:12019295-12019317 CTCCCAAGTAGTGGAATTGCAGG - Intronic
1163001175 19:14368568-14368590 CTATGCAGAAGTAGAATTGATGG + Intergenic
1163169584 19:15521626-15521648 ATCCCCAGAAGTAGAATGGATGG + Intronic
1163840746 19:19608050-19608072 CTCTTAAGAAGTAAAACTGCAGG + Intronic
1164751804 19:30661557-30661579 CTTCCAATAAGTAGAATTGCTGG - Intronic
928039098 2:27855820-27855842 CTCTTATGAAGTAAGATTGATGG - Intronic
929184353 2:39078425-39078447 GTACTTAGAAGTAGAATTGCTGG - Intronic
930585882 2:53266571-53266593 ATCCCAAGAAGGAGAATTAAAGG + Intergenic
930737032 2:54789770-54789792 GTCCTAATAGGTAGAATAGAAGG + Intronic
930903834 2:56541629-56541651 CTCCAATGTAGCAGAATTGAGGG - Intergenic
931028912 2:58148047-58148069 CTCCTGAGATGTAGAATTGCTGG + Intronic
933310830 2:80659680-80659702 ATCCCAAGAAGTAGGAGTGAGGG + Intergenic
935849822 2:107206206-107206228 CTCCTAAGAAGAGGAATTGGAGG + Intergenic
936166436 2:110124141-110124163 CACCTAAGAGGTAGGATGGAGGG + Intronic
936558344 2:113515183-113515205 GTCCTTAGAAGAAGAATAGAGGG - Intergenic
937367828 2:121277522-121277544 TACCTAAGAAGTAGAATTTCTGG - Intronic
939695519 2:145318667-145318689 CTACCAAGAAGTGGAATTGCTGG + Intergenic
939731466 2:145789700-145789722 CTCATATAAAGTAGAAATGATGG - Intergenic
940142564 2:150509380-150509402 TTCCTAATAAGTAGCATTTAGGG - Intronic
940976967 2:159957213-159957235 CTGGGAAGAAGTAGAAATGAAGG + Intronic
942128638 2:172854358-172854380 ATCCTATGAATTAGATTTGAAGG - Intronic
942501787 2:176598750-176598772 CTCTCAAGAAGAAAAATTGAAGG + Intergenic
945177423 2:207056789-207056811 ATTCCTAGAAGTAGAATTGATGG - Intergenic
945622755 2:212162070-212162092 ATACCAAGAAGTAGAATTGCTGG - Intronic
946263966 2:218522260-218522282 CTTATAAGAAATAGAATTTAAGG + Intronic
947379496 2:229531639-229531661 TACCTAAGGAGTAGAATTGCTGG - Intronic
948242249 2:236447332-236447354 CTCGTGAGAAGAAGAAATGAAGG + Intronic
948503743 2:238413591-238413613 ATGCTCAGAAGTAGAATTGCTGG + Intergenic
1168938575 20:1689502-1689524 ATCTTAAGAAGTATAATTTAAGG + Intergenic
1169334587 20:4745486-4745508 TTACTGAGAAGTAGAATTGGTGG - Intergenic
1169632877 20:7652728-7652750 CTCCTGAGAAGAAGAAAAGATGG - Intergenic
1169723171 20:8700987-8701009 CTCCTAGCAAGTAAAATTTAAGG + Intronic
1171438712 20:25144240-25144262 CTCAGAGGAAGTCGAATTGAGGG + Intergenic
1171926060 20:31189509-31189531 CTTCAATGGAGTAGAATTGAAGG + Intergenic
1172472782 20:35212768-35212790 ATTCTCAGAATTAGAATTGATGG + Intergenic
1172814299 20:37674011-37674033 CTCATAGGAAGTAGAAGCGAGGG + Intergenic
1173378803 20:42516646-42516668 GTACTTAGAAGTAGAATTAATGG + Intronic
1173675505 20:44831490-44831512 ATCCCTAGAAGTAGAATTGCGGG - Intergenic
1175772928 20:61635150-61635172 CTGCTGAGAAGTTGAATTGCTGG + Intronic
1177003601 21:15643405-15643427 TTCTTAGGCAGTAGAATTGATGG - Intergenic
1177018931 21:15828392-15828414 CACCTAAGTAGTGGCATTGAGGG + Intronic
1177113793 21:17061154-17061176 CCACTTAGAAGCAGAATTGAAGG + Intergenic
1177964048 21:27705060-27705082 ATACTTAGAAGTAGAATTGCTGG - Intergenic
1178962221 21:37075421-37075443 CACCTAAGTAGTAGATTTGCCGG + Intronic
1180652900 22:17393528-17393550 GTACTAAGAAGTGGAATTGGTGG + Intronic
1180819999 22:18820687-18820709 CTCACAAGAATTAAAATTGATGG + Intergenic
1181206221 22:21255159-21255181 CTCACAAGAATTAAAATTGATGG + Intergenic
1183673519 22:39287043-39287065 TTCCTTAGAAGGAGAATTGCTGG - Intergenic
1184899552 22:47436343-47436365 CCCCGAAGAACTAGAAATGATGG - Intergenic
1203220699 22_KI270731v1_random:40264-40286 CTCACAAGAATTAAAATTGATGG - Intergenic
1203270125 22_KI270734v1_random:46558-46580 CTCACAAGAATTAAAATTGATGG + Intergenic
949764104 3:7506499-7506521 CTACTAAGAAGTGGGATTGTTGG - Intronic
950197493 3:11019128-11019150 CTACTCAGAAGCAGAATTGCTGG - Intronic
950917527 3:16661079-16661101 TTCTTAAGATGTAGAATAGATGG + Intronic
951241519 3:20291253-20291275 CTTCTAAGAGGTAGAACAGAAGG - Intergenic
951748701 3:26009200-26009222 GTACTTAGAAGTGGAATTGATGG + Intergenic
952177607 3:30882674-30882696 ATACTCAGAAGTAGAATTGCTGG + Intronic
952914050 3:38218125-38218147 ATCCTCATAAGTAGAATTGCTGG + Intronic
953290888 3:41661089-41661111 ATCCTTCGAAGTAGAATTGAAGG + Intronic
953724418 3:45385257-45385279 CTACTCAGAAGTAGAGTTGCTGG + Intergenic
954519777 3:51214502-51214524 CTTCCATGAAGTAGAAGTGATGG + Intronic
955760365 3:62273678-62273700 CTCCTAAGAGGTACAATACATGG - Exonic
955786640 3:62547598-62547620 CTCCTAAGAGTTAGAATTTGCGG - Intronic
955862124 3:63342874-63342896 CTTCTAAGTTGTAGAATTTATGG + Intronic
956799799 3:72746738-72746760 TTCCTAAGAACAAAAATTGATGG + Intergenic
958258525 3:91352372-91352394 CTCATAAGAAGTAGGAGAGATGG + Intergenic
959615708 3:108345055-108345077 CTCCCAAGATGGGGAATTGAGGG + Intronic
960663278 3:120084418-120084440 CTTCTAAGAAGTAGGACTGGAGG + Intronic
961969849 3:130950537-130950559 TTCCTAGGAAGTAGTTTTGAGGG - Intronic
962610022 3:137067406-137067428 CTGCTAAGAAGTAGAAATAAGGG - Intergenic
964335475 3:155649676-155649698 CCAGTAAGAAGTAGAATTAATGG + Intronic
966621538 3:181969495-181969517 TCCCTGAGAAGTAGTATTGATGG + Intergenic
967489412 3:190072518-190072540 ATCCTTAGAAGTAGAATTGCTGG - Intronic
969918879 4:10518070-10518092 CTCCTAACATGGAGAATGGAGGG + Intronic
970139727 4:12968777-12968799 CTCCTAACAAGAAAAAATGATGG - Intergenic
970643968 4:18098200-18098222 ATACCTAGAAGTAGAATTGATGG - Intergenic
972373812 4:38451415-38451437 ATACTCAGAAGTAGAATTGCTGG - Intergenic
972844639 4:42972844-42972866 CTGCTAAAGAGTAGAACTGAAGG - Intronic
974277389 4:59741053-59741075 CTCCTAAGATATAGTATTCATGG - Intergenic
975439208 4:74391482-74391504 CTCCCAAGAAGTAAAATGGTTGG - Intergenic
975627914 4:76368302-76368324 TTCCTCAGAGGTAGAATTAAAGG - Intronic
975972529 4:80058770-80058792 CTTCTAAGATGTTGAATTCAAGG - Intronic
977122968 4:93127737-93127759 CTCCCAAGAACTAGAATTACAGG - Intronic
977783874 4:101009955-101009977 ATCCTAAGAAGCAGGAGTGAGGG - Intergenic
977809281 4:101340582-101340604 CTCATATGAAATATAATTGATGG + Intronic
978553240 4:109950374-109950396 ATCATAAGGAGTAGAATTGTTGG - Intronic
978882812 4:113728141-113728163 ATACTTAGGAGTAGAATTGATGG - Intronic
980282725 4:130741394-130741416 ATACTTAGAAGTAGAATTGCTGG + Intergenic
984673377 4:182518087-182518109 CTCCTATGAATATGAATTGAAGG - Intronic
985698278 5:1355356-1355378 CTGCTTAGAAGTGGAATTGAAGG + Intergenic
986028060 5:3869392-3869414 TTCATCAGAAGTAGAATTGCTGG - Intergenic
986299770 5:6468690-6468712 CTCCTAAGAAGTAGAATTGAAGG - Intronic
987804353 5:22743969-22743991 TTCCTTAGAAATAGAATTTATGG + Intronic
989697727 5:44223225-44223247 ACCCTTAGAAGTAGAATTGCTGG - Intergenic
991931414 5:71756523-71756545 GTTCTAAGAAGTAAAATTGCTGG - Intergenic
992196241 5:74341896-74341918 CTCCTAGAAAGCAGAAATGATGG - Intergenic
993521325 5:88905484-88905506 TACCTAAGAATGAGAATTGATGG - Intergenic
993554881 5:89323821-89323843 CTTCTAAGAATTTGTATTGAGGG - Intergenic
993620644 5:90163807-90163829 CTCCTAAGAAGTTGAAGATAAGG + Intergenic
996256199 5:121406058-121406080 ATTCTAAGATGTAGAATTGCTGG + Intergenic
996661552 5:126009355-126009377 CTCCTATGAACTAGCATTGCAGG - Intergenic
997343426 5:133165590-133165612 ATCCTCAGAAATAGAATTGCTGG + Intergenic
998239997 5:140432585-140432607 TACCTAAGAAGTAGAATTATTGG + Intronic
998257998 5:140603852-140603874 ATACTAAGGAGTAGAATTGATGG + Intergenic
999669816 5:153949167-153949189 CTTCTGAGAAGTAGAAATGCTGG - Intergenic
1000114541 5:158140867-158140889 ATCCCAAGAAGTAGAATTGCTGG - Intergenic
1000341708 5:160282009-160282031 CTAAAAAGAAGTAAAATTGAAGG + Intronic
1002914869 6:1520909-1520931 ATCCTGAGAAGTGGAATTGCTGG + Intergenic
1007379330 6:41477225-41477247 ATCCTTAGGAGTAGAATTGCTGG + Intergenic
1008014423 6:46502473-46502495 CTCCTATGAGGTAGGATTTAAGG - Intergenic
1008733231 6:54508804-54508826 ATACATAGAAGTAGAATTGAAGG - Intergenic
1008951744 6:57168898-57168920 CACATGAGAAGTAGAATTTATGG - Exonic
1008996738 6:57668315-57668337 CTCATAAGAAGTAGGAGAGATGG - Intergenic
1009344263 6:62594342-62594364 ATACTAAGAAGTGGAATTGCTGG - Intergenic
1009695469 6:67097096-67097118 CACCAAAGAAGTTGAAATGAAGG + Intergenic
1010342166 6:74766418-74766440 CTTCTAATAAGTAGAATGGGAGG - Intergenic
1011776143 6:90732847-90732869 ATACTTAGAAGTAGAATTGCTGG + Intergenic
1012217777 6:96609486-96609508 CTTTTAAAAAGTAGAATTCATGG + Intronic
1013874944 6:114813675-114813697 ATACTAAGAGGTAGAATTGAGGG - Intergenic
1014334293 6:120113078-120113100 ATCCTCAGAAGTGGAATTGCTGG - Intergenic
1014441719 6:121480941-121480963 CTGCTAAGAAGCAGATTTGGGGG - Intergenic
1014908559 6:127061198-127061220 CTCCTATGAAGAAGAAATAATGG - Intergenic
1015591754 6:134829310-134829332 CTCCCAAGAAGTAGAAGTGGAGG + Intergenic
1016156256 6:140812315-140812337 CTTCTAAAAAGTTGAATAGAAGG + Intergenic
1016576472 6:145574261-145574283 GTTCTTAGAAGTAAAATTGATGG - Intronic
1019888762 7:3928355-3928377 TTTCTAAGTTGTAGAATTGAGGG - Intronic
1019978785 7:4605814-4605836 CTCCTCAGATGTGGACTTGAAGG - Intergenic
1021244569 7:18245627-18245649 CTCCCAAAAAGTAACATTGAAGG - Intronic
1022534575 7:31087961-31087983 ATCCTTAGAAGTGGAATTGCTGG + Intronic
1022856463 7:34319696-34319718 CACCTATAAAGCAGAATTGAAGG + Intergenic
1023712032 7:43005283-43005305 GTACTCAGAAGTAGAATTGCTGG + Intergenic
1024082183 7:45864779-45864801 CTCCTAAAAAGTAGAAGAAAGGG + Intergenic
1026094632 7:67334522-67334544 TACCTAAGAATGAGAATTGATGG + Intergenic
1026655281 7:72251168-72251190 CACATCAGAAGCAGAATTGAAGG - Intronic
1028073212 7:86478052-86478074 CCCCAAAGAAGTAGAATTCTTGG + Intergenic
1028861187 7:95652482-95652504 ATACTTAGAAGTAGAATTGTGGG + Intergenic
1030511073 7:110482430-110482452 CACATACCAAGTAGAATTGATGG + Intergenic
1030511088 7:110482681-110482703 GTACTTAGAAGTAGAATTGCTGG - Intergenic
1031283311 7:119833247-119833269 CTCCTATCAAGTAAAAATGAAGG - Intergenic
1031945996 7:127841296-127841318 TCCCTAGGTAGTAGAATTGAGGG + Intronic
1032624813 7:133580354-133580376 CTACTCAGAAGTGGAATTGTTGG + Intronic
1032728746 7:134616616-134616638 TTCCAAAGAAGTAAAATTGGAGG + Intergenic
1032803013 7:135331518-135331540 CTCCTATCAAGAAGAATTGAGGG - Intergenic
1032876451 7:136043682-136043704 CTTCTAAGGGGCAGAATTGAGGG + Intergenic
1034102647 7:148464100-148464122 CTCAAAAGAAGTAGAATTTCTGG - Intergenic
1034720940 7:153292131-153292153 CTCCTAAGAAAAAGAATAGGAGG + Intergenic
1036989121 8:13571718-13571740 ATACTTAGAAGTAGAATTGCTGG + Intergenic
1038320568 8:26522361-26522383 CTGCCTAGAAGTAGAATTGCTGG + Intronic
1038621488 8:29147460-29147482 CTCCTGAGAAGCAGAACTGCCGG - Exonic
1040845025 8:51828727-51828749 CTACTAAAAAGTAGACTTCATGG + Intronic
1040885385 8:52257293-52257315 CTACTTAGAAGAAGAATTGCTGG + Intronic
1041264270 8:56048437-56048459 CTCCTAAAAAAAAGAAGTGATGG - Intergenic
1041330909 8:56723713-56723735 TTCCTAAGAAACAGAATTGCTGG - Intergenic
1041735017 8:61101084-61101106 TACCTAAGAAGTGGAATTGCTGG + Intronic
1041881947 8:62762017-62762039 CTCTTAGGAAGTAGCATTGCTGG + Intronic
1043842226 8:85120961-85120983 ATCCCCAGAAGTAGAATTGCTGG + Intronic
1044883557 8:96749840-96749862 ATTCTTAGAAGTAGAATTGGTGG - Intronic
1044886723 8:96786538-96786560 ATACCAAGAAGTAGAATTGCTGG + Intronic
1045004481 8:97906047-97906069 ATACTAAGGAGTAGAATTGCTGG + Intronic
1045122605 8:99054186-99054208 ATACTGAGAAGTAGAATTGCTGG + Intronic
1045378991 8:101604214-101604236 TACCTAAGAAGTAGATTTGTTGG + Intronic
1046817596 8:118601792-118601814 CTCCAAAGATGAAGAACTGATGG + Intronic
1048676659 8:136791559-136791581 CTCTGAAGAAGTGGCATTGAAGG + Intergenic
1049894523 9:101083-101105 GTCCTTAGAAGAAGAATAGAGGG + Intergenic
1050486765 9:6142655-6142677 CTTCTAAGAAGCTGAGTTGAGGG - Intergenic
1050890935 9:10823750-10823772 CTTCTCAGAAGGAGAACTGATGG - Intergenic
1051459571 9:17295839-17295861 CTCTCAATAAGTGGAATTGAAGG - Intronic
1052681245 9:31695904-31695926 ATGCTCAGTAGTAGAATTGATGG - Intergenic
1053735730 9:41101073-41101095 GTCCTTAGAAGAAGAATAGAGGG + Intergenic
1054692647 9:68330325-68330347 GTCCTTAGAAGAAGAATAGAGGG - Intronic
1055536585 9:77252990-77253012 ATACTCAGAAGTAGAATTGCTGG + Intronic
1055862767 9:80773105-80773127 TTCCAAACAAGTAGATTTGAGGG + Intergenic
1056145715 9:83727015-83727037 ATACTTAGAAGTAGAATTGCTGG - Intergenic
1056828831 9:89897296-89897318 CTCCTAAGCAGGGGAACTGAAGG + Intergenic
1057015880 9:91651288-91651310 CTCATAAAGAGTAGAAATGATGG + Intronic
1057943426 9:99304728-99304750 ATTCTAAGAAGTAGAATTCCTGG - Intergenic
1058324672 9:103680428-103680450 CTACAAACAGGTAGAATTGAAGG - Intergenic
1058456690 9:105144331-105144353 ATACTCAGAAGTAGAATTGCTGG - Intergenic
1058640652 9:107080640-107080662 CTCTCAAGAAGTAAAATTTAGGG - Intergenic
1059640817 9:116214862-116214884 TTCCTTAGAAGTGGAATTGCTGG - Intronic
1060562175 9:124554874-124554896 CTCCTACAGGGTAGAATTGATGG - Intronic
1061349807 9:130055165-130055187 CTTCTAAGAAGTGGAACTGTAGG + Intronic
1186946149 X:14569735-14569757 ATACTAAGAAGTGGAATTGCTGG - Intronic
1187153062 X:16698849-16698871 CTGCTCAAAAGTAGAACTGAAGG - Intronic
1189440307 X:41029931-41029953 ATCTTTAGAAGTGGAATTGATGG - Intergenic
1190749093 X:53345509-53345531 TTACTAAGAAGTATAAGTGACGG + Intergenic
1192866714 X:75141695-75141717 TTTCTTAGAAGTAGAATTGTTGG + Intronic
1194008210 X:88523767-88523789 CTCCTAAGAAGTTGAACAGCCGG + Intergenic
1195501091 X:105600763-105600785 CTACTAAGAAGTAGAATTGCTGG + Intronic
1196038109 X:111169411-111169433 CTTGTAAGAATTAGAACTGAAGG - Intronic
1196559861 X:117132898-117132920 CACCAAAGAAGTAGTGTTGAAGG + Intergenic
1196943417 X:120799928-120799950 ATACTCAGAAGTAGAATTGCTGG - Intergenic
1197430761 X:126360351-126360373 CCCCTAACAAGTGGAATTGGAGG - Intergenic
1197620897 X:128746786-128746808 CTCCTTAAAAGGAAAATTGAAGG + Intergenic
1197626744 X:128810415-128810437 CTCCTAAAAAGTGCATTTGATGG + Intergenic
1199795168 X:151188424-151188446 ATACTCAGAAGTAGAATTGCTGG + Intergenic