ID: 986307819

View in Genome Browser
Species Human (GRCh38)
Location 5:6528732-6528754
Sequence CACCCTCAGCTTCCCGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986307814_986307819 -1 Left 986307814 5:6528710-6528732 CCTCAGACAGCCCAGCGAGTCTC No data
Right 986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG No data
986307810_986307819 16 Left 986307810 5:6528693-6528715 CCTCGGCATCCTTCCCTCCTCAG No data
Right 986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG No data
986307812_986307819 3 Left 986307812 5:6528706-6528728 CCCTCCTCAGACAGCCCAGCGAG No data
Right 986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG No data
986307809_986307819 30 Left 986307809 5:6528679-6528701 CCTGGGAAAGAGGGCCTCGGCAT No data
Right 986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG No data
986307813_986307819 2 Left 986307813 5:6528707-6528729 CCTCCTCAGACAGCCCAGCGAGT No data
Right 986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG No data
986307811_986307819 7 Left 986307811 5:6528702-6528724 CCTTCCCTCCTCAGACAGCCCAG No data
Right 986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986307819 Original CRISPR CACCCTCAGCTTCCCGGGCC AGG Intergenic
No off target data available for this crispr