ID: 986310095

View in Genome Browser
Species Human (GRCh38)
Location 5:6545136-6545158
Sequence CCCCACTGGGTCCCCTGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986310089_986310095 -9 Left 986310089 5:6545122-6545144 CCAGCCATCACCATCCCCACTGG No data
Right 986310095 5:6545136-6545158 CCCCACTGGGTCCCCTGCACAGG No data
986310087_986310095 -1 Left 986310087 5:6545114-6545136 CCTTTCACCCAGCCATCACCATC No data
Right 986310095 5:6545136-6545158 CCCCACTGGGTCCCCTGCACAGG No data
986310082_986310095 30 Left 986310082 5:6545083-6545105 CCTGCACTGGCTATGTGCCGGCG No data
Right 986310095 5:6545136-6545158 CCCCACTGGGTCCCCTGCACAGG No data
986310086_986310095 13 Left 986310086 5:6545100-6545122 CCGGCGTCTGGGGTCCTTTCACC No data
Right 986310095 5:6545136-6545158 CCCCACTGGGTCCCCTGCACAGG No data
986310088_986310095 -8 Left 986310088 5:6545121-6545143 CCCAGCCATCACCATCCCCACTG No data
Right 986310095 5:6545136-6545158 CCCCACTGGGTCCCCTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986310095 Original CRISPR CCCCACTGGGTCCCCTGCAC AGG Intergenic
No off target data available for this crispr