ID: 986313729

View in Genome Browser
Species Human (GRCh38)
Location 5:6572597-6572619
Sequence CTGTGTGAGCCCCGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986313716_986313729 16 Left 986313716 5:6572558-6572580 CCTCCCCAGGGCCTTCGGCTCTC No data
Right 986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG No data
986313724_986313729 -7 Left 986313724 5:6572581-6572603 CCACACCCTCGGCAGGCTGTGTG No data
Right 986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG No data
986313719_986313729 11 Left 986313719 5:6572563-6572585 CCAGGGCCTTCGGCTCTCCCACA No data
Right 986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG No data
986313720_986313729 5 Left 986313720 5:6572569-6572591 CCTTCGGCTCTCCCACACCCTCG No data
Right 986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG No data
986313723_986313729 -6 Left 986313723 5:6572580-6572602 CCCACACCCTCGGCAGGCTGTGT No data
Right 986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG No data
986313714_986313729 18 Left 986313714 5:6572556-6572578 CCCCTCCCCAGGGCCTTCGGCTC No data
Right 986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG No data
986313717_986313729 13 Left 986313717 5:6572561-6572583 CCCCAGGGCCTTCGGCTCTCCCA No data
Right 986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG No data
986313712_986313729 26 Left 986313712 5:6572548-6572570 CCTCGGCGCCCCTCCCCAGGGCC No data
Right 986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG No data
986313715_986313729 17 Left 986313715 5:6572557-6572579 CCCTCCCCAGGGCCTTCGGCTCT No data
Right 986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG No data
986313709_986313729 30 Left 986313709 5:6572544-6572566 CCATCCTCGGCGCCCCTCCCCAG No data
Right 986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG No data
986313718_986313729 12 Left 986313718 5:6572562-6572584 CCCAGGGCCTTCGGCTCTCCCAC No data
Right 986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986313729 Original CRISPR CTGTGTGAGCCCCGGGATGA AGG Intergenic
No off target data available for this crispr