ID: 986317614

View in Genome Browser
Species Human (GRCh38)
Location 5:6601077-6601099
Sequence CTGCTTTACATTAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986317614_986317621 8 Left 986317614 5:6601077-6601099 CCATTTTTCCTAATGTAAAGCAG 0: 1
1: 0
2: 3
3: 30
4: 262
Right 986317621 5:6601108-6601130 AGGTGGTTTTAAGAAGTGAGAGG No data
986317614_986317620 -9 Left 986317614 5:6601077-6601099 CCATTTTTCCTAATGTAAAGCAG 0: 1
1: 0
2: 3
3: 30
4: 262
Right 986317620 5:6601091-6601113 GTAAAGCAGGGGCACAAAGGTGG 0: 1
1: 0
2: 1
3: 22
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986317614 Original CRISPR CTGCTTTACATTAGGAAAAA TGG (reversed) Intronic
903872282 1:26444906-26444928 ATGCTTCACATTTGGAAAATGGG - Intronic
904323457 1:29711563-29711585 CTGCTTTACAATCTCAAAAAAGG - Intergenic
905676514 1:39829610-39829632 CTGTATTATATTAAGAAAAATGG + Intergenic
905727894 1:40270053-40270075 CTACTTTACATTATTAAAATTGG + Exonic
906405105 1:45535619-45535641 CTGCTTTTCATTATTAAATAAGG + Intergenic
908338425 1:63150957-63150979 AAGCTTTACATTATGAAATAAGG + Intergenic
908362264 1:63381014-63381036 ATGCTAAACATTAAGAAAAATGG + Intronic
910127481 1:83860414-83860436 CTATTTTACATGAGGAATAAAGG - Intergenic
910494099 1:87806711-87806733 CTGTTTTGCCTTATGAAAAAGGG + Intergenic
910542840 1:88380479-88380501 TGGCTTTACATAATGAAAAAAGG + Intergenic
910731567 1:90403129-90403151 CCCCTTTACACTAGGCAAAAGGG + Intergenic
911341877 1:96649363-96649385 CTGCTTTACTTTCCAAAAAAGGG + Intergenic
913126838 1:115798806-115798828 CTGTTTTCCTTTAGGAATAAAGG - Intergenic
914373122 1:147048568-147048590 AGGTTTTATATTAGGAAAAAGGG + Intergenic
915292529 1:154896304-154896326 TTGCTTTACAAAAGGAAAGAGGG - Intergenic
915623900 1:157102865-157102887 CTGCTTCACCTTAGGAAAATGGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917541246 1:175916721-175916743 ATGCATTAAAATAGGAAAAAGGG + Intergenic
918032570 1:180829879-180829901 ATGCATTAAATAAGGAAAAAAGG - Intronic
918954013 1:191181648-191181670 CTATTTTACATTTGGAAAAAAGG - Intergenic
921445854 1:215246616-215246638 CTTATTTACCTTAGGCAAAAAGG - Intergenic
923028564 1:230226811-230226833 CTACCCTACATAAGGAAAAATGG - Intronic
923867610 1:237956853-237956875 CTGCTTTACAATGTGTAAAAGGG - Intergenic
924417297 1:243870458-243870480 CTGTTGAACAATAGGAAAAAAGG + Intergenic
1063350421 10:5349162-5349184 CTGCTGTAAGTTAGGAAAACAGG - Intergenic
1065131622 10:22626982-22627004 TTTCATTACTTTAGGAAAAAGGG + Intronic
1066503832 10:36021365-36021387 CTGGCTAACATCAGGAAAAATGG - Intergenic
1067156738 10:43788204-43788226 GTGCTTTAAAAAAGGAAAAAAGG + Intergenic
1068379102 10:56225639-56225661 ATGCTTTACATAACTAAAAATGG - Intergenic
1068621398 10:59186927-59186949 CTGCATTCAATTAGGAAAAGAGG - Intronic
1071322049 10:84471730-84471752 GTAATTTACATTAGGTAAAATGG - Intronic
1071389263 10:85154614-85154636 CTGCTTTAAATTTTTAAAAAAGG + Intergenic
1071549329 10:86554356-86554378 CTGCTTAACTTAAGCAAAAATGG + Intergenic
1072636793 10:97183474-97183496 TTGCTTTCCATCAGGAAAATGGG - Intronic
1076237099 10:128871826-128871848 CTGATTAACATTTGGAAGAAGGG + Intergenic
1077742747 11:4865282-4865304 TTCTTTTACATTAGGAAAAAAGG + Intronic
1077753736 11:5003117-5003139 ATGCTTTAGAAGAGGAAAAAAGG + Intergenic
1078095957 11:8297453-8297475 CTTCTTTAGATTAGGAAGAATGG - Intergenic
1078498020 11:11840409-11840431 CTGGTTGACATCAGGAAAGATGG + Intergenic
1079602914 11:22331837-22331859 CTTCTTTGTACTAGGAAAAAAGG + Intergenic
1079781689 11:24614992-24615014 CTGCCTGTCATTAAGAAAAAAGG + Intronic
1080321538 11:31015625-31015647 CTGCTGAACATTTGGAGAAAAGG + Intronic
1080611836 11:33911064-33911086 CTACTGTAAATTAGGAAGAAGGG - Intergenic
1081038164 11:38176550-38176572 CTGCTGAACATTGGGAAGAAGGG + Intergenic
1081475876 11:43430507-43430529 CTGCCTTACAATATGAAAATAGG - Intronic
1082645260 11:55715809-55715831 CTGCTTTACTGTTTGAAAAAGGG - Intergenic
1083524642 11:63350745-63350767 CTTCCTTACATTCAGAAAAAAGG + Intronic
1085948354 11:81299537-81299559 CTACCTTAAATTAGGAAAATTGG + Intergenic
1086201444 11:84207946-84207968 TTTCTTTACATGGGGAAAAAAGG + Intronic
1088302139 11:108370097-108370119 CTGAGTGACATTAGGAACAAGGG - Intronic
1089784721 11:120899748-120899770 GTGCTTTAGATTAGTTAAAAGGG - Intronic
1090155253 11:124430620-124430642 CTGGTTAACTTTAGCAAAAAAGG - Intergenic
1093214593 12:16348143-16348165 CTGCCTTACAATAGGCATAAAGG - Intronic
1094095139 12:26695301-26695323 CTTCTTTACAGAAGAAAAAAGGG + Intronic
1095313530 12:40729673-40729695 CTGCTTTATTTTAGGCACAATGG - Intronic
1100938496 12:99697954-99697976 ATGCTTTTGATTAAGAAAAACGG + Intronic
1101797489 12:107988870-107988892 CTGGTTAACATGAGGGAAAATGG + Intergenic
1102310222 12:111838934-111838956 CTGATTTAGATTAGGAAAGGAGG + Intergenic
1102911336 12:116716577-116716599 CTGCATTACAGTAGGAAAAATGG + Exonic
1107198988 13:37690603-37690625 CTTGTTTAAATTAGAAAAAAGGG - Intronic
1109724684 13:66324384-66324406 ATTATTTCCATTAGGAAAAATGG + Intronic
1109930052 13:69204754-69204776 ATGCTTTCCAATAGTAAAAAGGG + Intergenic
1110246334 13:73328479-73328501 CTGCTTTACAAAAGAAAAAAAGG + Intergenic
1110771573 13:79354523-79354545 CTGCTTCACAACAGGCAAAATGG + Exonic
1110931634 13:81225683-81225705 CAGGTTTAGAATAGGAAAAAGGG + Intergenic
1111252311 13:85618568-85618590 CTGCTTTCCATAAGGAAAAGTGG - Intergenic
1111415849 13:87942910-87942932 CTGCTTTACAGGAGATAAAACGG + Intergenic
1111423229 13:88045621-88045643 CTGGTTCACATTAAGGAAAATGG + Intergenic
1111958854 13:94787191-94787213 CTGCTATCCATTAGGTTAAATGG - Intergenic
1113071555 13:106426384-106426406 CTCCTTTACCTTGGGAAATATGG + Intergenic
1113664739 13:112133490-112133512 CTGCTTTACAAAATGAAAATGGG - Intergenic
1117290218 14:54325059-54325081 CTGCTTTACTTTACCAGAAATGG - Intergenic
1118013487 14:61634480-61634502 CTGCTTTAATTTAGAAAATAAGG + Intronic
1118331255 14:64817695-64817717 CTCCTGTACATAAGGGAAAAGGG + Intronic
1119324222 14:73750010-73750032 CTGCTTTTCCCTAGGAAAAATGG + Intronic
1120537215 14:85711838-85711860 CTGCTTTCCATTAGGCATCAAGG - Intergenic
1120798661 14:88665521-88665543 ATACTTTAAATTAGAAAAAAGGG - Intronic
1122067985 14:99186860-99186882 CTGCTTTCCATAAGGTATAAAGG + Intronic
1122723971 14:103738615-103738637 CTGCTTTGCATAAGGAAAACAGG - Intronic
1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG + Intergenic
1124604086 15:31157934-31157956 CTGCTTTCGATTAGGAAACCGGG + Intronic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1125584711 15:40812155-40812177 GTTTTTTACATTTGGAAAAATGG + Intronic
1125958147 15:43805376-43805398 CTGCATGACTTTAGGAAGAATGG + Exonic
1126426632 15:48534446-48534468 CTCCTCTACATTAGGAAACATGG - Intronic
1126921987 15:53537020-53537042 CTGTTTTTCATTAAGAAAAAAGG - Intronic
1127236520 15:57058742-57058764 ATGCTACACATTAGTAAAAAAGG - Intronic
1127559189 15:60118889-60118911 CTGCTTGTCATTATGCAAAAAGG - Intergenic
1127841140 15:62833151-62833173 ATACTTAACATTAGGTAAAAGGG + Intronic
1131339896 15:91589049-91589071 CTACTGCCCATTAGGAAAAATGG + Intergenic
1131796498 15:96022579-96022601 ATGCATAACATTAGGAAAGAAGG + Intergenic
1132014192 15:98301362-98301384 TTGTTTTATGTTAGGAAAAATGG + Intergenic
1132206671 15:99990748-99990770 GTGCTTTACGGAAGGAAAAATGG - Intronic
1134845853 16:17439675-17439697 CTGCTTTCCATTGTTAAAAAGGG + Intronic
1136028023 16:27482330-27482352 CTGCTTGGCATTTGGGAAAAAGG + Intronic
1137566835 16:49538568-49538590 CAGCTTTGCACTGGGAAAAAGGG - Intronic
1139417689 16:66827772-66827794 CTGCTTTAAATCAGGTAACAGGG - Intronic
1140265711 16:73418685-73418707 CTGTTTTACATTTGGAAATACGG - Intergenic
1144922238 17:18773733-18773755 ATGCTTAACAGTAGGAAAAGTGG + Intronic
1146131979 17:30285654-30285676 ATGCTTTCCATAAGGAGAAAAGG + Intronic
1148251818 17:46088135-46088157 CTGCTTTACACAAGGACCAAAGG + Intronic
1148368405 17:47073859-47073881 CTGCTTTACACAAGGACCAAAGG + Intergenic
1148896996 17:50844579-50844601 CTGTTTTACAATAGGACAAGGGG - Intergenic
1149078264 17:52623204-52623226 CTGCCTTACATTAGGACATATGG - Intergenic
1153344288 18:4009363-4009385 CTGCAATACAGTAGGAAACATGG - Intronic
1153983609 18:10333519-10333541 CTAGTTTACATTTGGGAAAATGG - Intergenic
1154965434 18:21351239-21351261 CTGCTTAACATTTTGAAAACTGG + Intronic
1155275094 18:24179472-24179494 ATGATCTACATAAGGAAAAAAGG + Intronic
1155424039 18:25687460-25687482 CTGATTTACATTAGAAAAAGAGG + Intergenic
1156584121 18:38413124-38413146 TTTCTTTACATTAAAAAAAAAGG + Intergenic
1159525066 18:69578199-69578221 TTGCTTTACAAAAGAAAAAATGG - Intronic
925738484 2:6984702-6984724 TTGCTATACATTGGGAAAATAGG + Intronic
926433487 2:12814985-12815007 GTGCTTTACAATAAGAAATAAGG - Intergenic
926729499 2:16025587-16025609 CTACTTTACATTTTAAAAAATGG + Intergenic
928712709 2:34025271-34025293 CTGCTTTGCATTTTGGAAAATGG - Intergenic
928724961 2:34161697-34161719 CTGCTTGACATTAAGATACAAGG - Intergenic
931135180 2:59391177-59391199 CTTCTTCACAAGAGGAAAAATGG - Intergenic
931256659 2:60580105-60580127 ATGCTTTAGAATAGGTAAAAGGG + Intergenic
932066189 2:68564032-68564054 CATCTTTACTTTAGAAAAAATGG - Intronic
932626390 2:73299647-73299669 CTGCATGCCATTAGGAAAAGTGG + Intergenic
932965329 2:76467828-76467850 CTGCTTTACATAAATAAATAAGG - Intergenic
932968055 2:76501754-76501776 TTGTTTTACAATAGGAGAAAGGG + Intergenic
935161100 2:100530182-100530204 CAGCTTTTCATTAGGAAAACTGG + Intergenic
935638656 2:105270158-105270180 CTACTTTACATTGGAATAAAGGG - Intronic
935704079 2:105840838-105840860 CAGCTGTTCATTAGGAAAAGGGG - Intronic
936808507 2:116367259-116367281 GTCCTTTATTTTAGGAAAAAAGG - Intergenic
937653408 2:124346620-124346642 CTAATTAACATTAGGTAAAATGG + Intronic
939252753 2:139704066-139704088 CTGTTGTACATTAGCAAAACTGG + Intergenic
939284275 2:140109011-140109033 CTTGTTTACATTAGAAAAAAAGG - Intergenic
939523934 2:143268216-143268238 ATGCTCTACATTAGAAAAATAGG - Intronic
939537057 2:143444983-143445005 TTTATTTACATTAGGAAAATTGG - Intronic
940239524 2:151547860-151547882 ATGATTGAGATTAGGAAAAAAGG + Intronic
940395186 2:153182008-153182030 CTGCTTATTATTAAGAAAAATGG - Intergenic
941426903 2:165358438-165358460 CTGCTTCATTTTAGGGAAAATGG + Intronic
941613155 2:167685922-167685944 CTGCTTTACTTAAATAAAAAAGG + Intergenic
942143792 2:173005453-173005475 TTGCTTTACATTTGGAGAACTGG - Intronic
942319353 2:174723046-174723068 CTGCTTAGACTTAGGAAAAATGG - Intergenic
942564634 2:177254332-177254354 CTGCTTCAGGTTAGGATAAAAGG + Intronic
942876200 2:180801835-180801857 CTGGTTTCCAATAAGAAAAAAGG + Intergenic
943051441 2:182918269-182918291 CTGCTTTACATTAACAATGAGGG - Intronic
944914341 2:204342365-204342387 CTGCTATAAATTAGGAGAAATGG + Intergenic
945075079 2:206030713-206030735 CTGCTTTACCTGTGGAATAAAGG - Intronic
945427829 2:209729145-209729167 CTGGTTAGCATTAGGGAAAATGG + Intronic
946851812 2:223914835-223914857 CTGCTTTAGCTGAAGAAAAATGG - Intronic
947333275 2:229052757-229052779 CTAGTTGACATGAGGAAAAAAGG + Intronic
947513225 2:230778278-230778300 CGGCCTTACGTTAGGAAACAAGG - Intronic
947649113 2:231769399-231769421 CTGCTAAAGATTAAGAAAAAGGG - Intronic
1170157431 20:13281386-13281408 CTGCTTTCCAAGAGGAAAGACGG + Intronic
1171283873 20:23922267-23922289 CAGCTGTGCATTAGGATAAATGG + Intergenic
1171790397 20:29517781-29517803 TTACTTTACATTGGGCAAAAGGG - Intergenic
1177233358 21:18351827-18351849 ATGCTATATAATAGGAAAAATGG + Intronic
1178010692 21:28282706-28282728 CCGCTTTACATACGGAGAAAGGG + Intergenic
1179305927 21:40154019-40154041 CTGCTTTACAATAGGTATAGGGG + Intronic
1183222286 22:36523387-36523409 CTCCTTTAAACTACGAAAAATGG + Intronic
1185033671 22:48459512-48459534 CTGCTGGACCTTAGGACAAATGG - Intergenic
950337216 3:12205601-12205623 CTGCTTTACAAATAGAAAAACGG - Intergenic
950849266 3:16047186-16047208 CTGATTGACATCAGGAAAAATGG + Intergenic
952592021 3:34967348-34967370 GTGCTATATATTAGGATAAAGGG - Intergenic
956276434 3:67506686-67506708 TTGCTTTGCATGAAGAAAAATGG - Intronic
957297618 3:78353188-78353210 TTGCATAACATTAGGAAACAAGG + Intergenic
958108306 3:89105849-89105871 CTGCTTGTCACTGGGAAAAAAGG - Intergenic
959613577 3:108322142-108322164 CTGCTTAACATTAAGAATGAGGG + Intronic
959856286 3:111162434-111162456 CTTCTTCACATTAGCAAAAGGGG - Intronic
960463643 3:117968395-117968417 CTGCATCACATTAGGAGAATAGG - Intergenic
962093139 3:132266460-132266482 GGGCTTTTCATTTGGAAAAAAGG - Intronic
962320888 3:134389394-134389416 CTGATTTCCATGAGGAACAATGG + Intergenic
962375418 3:134854846-134854868 TTGTTTTACAATATGAAAAAAGG - Intronic
963998358 3:151738162-151738184 CTGCCTTACAAAAGGAAATAAGG - Intronic
965850647 3:173018793-173018815 CACCTCTACATTAGGAAATAAGG + Intronic
967146054 3:186607252-186607274 CTCCTTTACAGAGGGAAAAAAGG - Intergenic
969727394 4:8928944-8928966 CACTTTTACATTAAGAAAAAGGG + Intergenic
970743585 4:19267166-19267188 CTGCTTTACCTCAGGAAAAAAGG - Intergenic
971414347 4:26409981-26410003 CTGCATTACTTTATGATAAAGGG + Intronic
971536463 4:27758114-27758136 CTGCATTTGATTAAGAAAAAAGG - Intergenic
974003386 4:56532369-56532391 TTGCTTTTCATTAAAAAAAAAGG - Intronic
974641562 4:64639456-64639478 CTGTTTTCCATTAAGAAAAAGGG + Intergenic
976917768 4:90399396-90399418 TTGTTTTACATCAGGAAGAATGG - Intronic
977106963 4:92898558-92898580 CTGCTTTGCATCAGGGGAAAAGG + Intronic
977678294 4:99771461-99771483 CTGCCTTAAAGTAGGAAAACTGG - Intergenic
978821760 4:112974884-112974906 CTGCTTGAAAGTAGGAAAGAAGG + Intronic
978870155 4:113566130-113566152 CTACTTTCCATTGTGAAAAAGGG - Intronic
980932654 4:139196319-139196341 TTGGTTTACATTAGGATACAAGG - Intergenic
981097000 4:140792291-140792313 CTGTTTTAAAGTATGAAAAAGGG + Intergenic
981215419 4:142160263-142160285 CTGCTTTCCATTTTAAAAAATGG - Intronic
983049040 4:163022453-163022475 ATCATTTATATTAGGAAAAAAGG + Intergenic
983070482 4:163262024-163262046 CAACTTTACAATAGGCAAAAGGG - Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984241243 4:177222120-177222142 CTGCTCTTCATTAGGAGCAATGG - Intergenic
986317614 5:6601077-6601099 CTGCTTTACATTAGGAAAAATGG - Intronic
986432599 5:7696253-7696275 CTGCTTAACAATAGGAATAGAGG - Intronic
987011569 5:13771284-13771306 ATGGTTTACATCAGGACAAATGG + Intronic
988331446 5:29845796-29845818 TTCTTTGACATTAGGAAAAAAGG - Intergenic
988688881 5:33551944-33551966 AGGCTTTACATTAGGAAAACAGG - Intronic
989213883 5:38884015-38884037 GTGCCTTTCATTAGGAATAAAGG + Exonic
989230332 5:39078478-39078500 CTGATTGACATTAGGGAAGATGG - Intergenic
989802834 5:45565299-45565321 CTGCTATGCACTAGGAATAATGG - Intronic
990130617 5:52578354-52578376 TTCCTTTCCATAAGGAAAAATGG - Intergenic
990384612 5:55247741-55247763 TTGCTTTACATTTGGAACAGGGG - Intergenic
990387014 5:55274946-55274968 CTGCTGTACTTTTGGTAAAATGG + Exonic
990720420 5:58689081-58689103 CAGCTTTCTATTTGGAAAAATGG - Intronic
992222108 5:74583325-74583347 ATGATTTACCTTAGGAAAAAAGG + Intergenic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
993237814 5:85337142-85337164 GTGCTTTAAATTAGAAAGAAAGG - Intergenic
995406381 5:111801362-111801384 CTGCTTTAAATTCGAAAAGAAGG + Intronic
995583246 5:113622159-113622181 TTGCTTTTGATAAGGAAAAATGG + Intergenic
996414230 5:123192637-123192659 GTGATATACATTAGGACAAATGG + Exonic
996670844 5:126115174-126115196 AAACTTTACAGTAGGAAAAAGGG + Intergenic
996735001 5:126750331-126750353 CGGCTTTAGAATAGGAAAGAAGG + Intergenic
999356959 5:150944323-150944345 CTGCTTTGGTTTAGGAAATAAGG - Intergenic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
999917475 5:156278825-156278847 CTCTTTTGCATTTGGAAAAATGG + Intronic
1000559291 5:162765964-162765986 CTGCTTTACATAACATAAAAAGG - Intergenic
1000882334 5:166712714-166712736 CTGCTTTACATTTGTATGAAGGG - Intergenic
1002912366 6:1499802-1499824 CTGCTTTTCAGAGGGAAAAAGGG - Intergenic
1004325413 6:14670106-14670128 CTGCTGTACATTGGGACAACTGG + Intergenic
1008366824 6:50690779-50690801 CTGTCTTCCATGAGGAAAAAAGG + Intergenic
1008377027 6:50803622-50803644 CTGCATTAAATTAAGAGAAATGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1008992890 6:57624610-57624632 CTGCCTTACATTAGGCACAGGGG - Intronic
1010131411 6:72498430-72498452 CTCTTTTACAATAGGAAATATGG - Intergenic
1010731600 6:79397046-79397068 CTCATTTACATTTGGAAAGAGGG + Intergenic
1011512415 6:88115594-88115616 CTGTTTTGCATTAGGAAACATGG - Intergenic
1014298504 6:119650867-119650889 CTGCTTTACAGATGGTAAAATGG + Intergenic
1014334171 6:120111118-120111140 GTACTGTACATAAGGAAAAAAGG - Intergenic
1014966837 6:127764570-127764592 CTGCATTATTTTAGGAAATAAGG - Intronic
1015724118 6:136282280-136282302 CTTGTTTACATTAGGGAAATGGG + Intronic
1017371748 6:153718270-153718292 GTGATTTACATTAATAAAAAAGG + Intergenic
1020842892 7:13243006-13243028 TTTCTGTACATTAGGAAAACAGG - Intergenic
1021134901 7:16953688-16953710 CTGCTATACATAAGGACACATGG - Intergenic
1021548400 7:21842387-21842409 CTGCTGTACTTTAGGAAATTTGG + Intronic
1022691144 7:32656415-32656437 ATGACATACATTAGGAAAAAGGG + Intergenic
1022918705 7:34990321-34990343 ATGACATACATTAGGAAAAAGGG + Intronic
1023896490 7:44437896-44437918 CTACTTTAACTTAGTAAAAATGG + Intronic
1026118750 7:67518387-67518409 TAGTTTTACATTAGGATAAATGG + Intergenic
1027435257 7:78157862-78157884 CAGCTTTTCATGAAGAAAAAGGG + Intronic
1027839706 7:83293332-83293354 CTGGTTCACATCAGGAAAGATGG + Intergenic
1028264723 7:88708937-88708959 CTGCTTTACTTTGGGAGAAATGG + Intergenic
1030486764 7:110178548-110178570 CTGCATTACATAAAGAAATATGG - Intergenic
1031192135 7:118566399-118566421 ATGCTGAACATTAGTAAAAAGGG + Intergenic
1031370701 7:120961927-120961949 CTGATTTACAATAGTAAAGAGGG - Intronic
1031383857 7:121121685-121121707 CTGTTTTAAATTAGGAGGAAAGG + Intronic
1033761518 7:144441291-144441313 CTGCTTAGGATTAGGAAGAAAGG - Intergenic
1035347948 7:158218839-158218861 GGGCTTTACATAATGAAAAAGGG + Intronic
1035361940 7:158318947-158318969 CAGCTTTTCATAAAGAAAAATGG + Intronic
1035964053 8:4170445-4170467 CACCTATAGATTAGGAAAAAGGG - Intronic
1037938735 8:22933192-22933214 CTGCTTTGCCTAAGGGAAAAGGG + Intronic
1041913647 8:63116891-63116913 CTAATTGACATTAGGAAAAGTGG - Intergenic
1042302814 8:67303776-67303798 CTGCCTGAAATTTGGAAAAAAGG + Intronic
1042422766 8:68611354-68611376 CTGCATTTCTTTTGGAAAAAGGG + Intronic
1043594354 8:81866444-81866466 GTGCTTTACATAATGACAAAGGG + Intergenic
1043810983 8:84740460-84740482 CTTCTAAAGATTAGGAAAAAGGG - Intronic
1044289952 8:90456254-90456276 TTAATATACATTAGGAAAAAAGG - Intergenic
1044526261 8:93255125-93255147 TTGATTTATATCAGGAAAAAAGG + Intergenic
1045537763 8:103048448-103048470 GTGCTTTCCCTTAGGAAGAAAGG - Intronic
1046775112 8:118155993-118156015 ATGCTATATATTATGAAAAAAGG - Intergenic
1046939317 8:119915638-119915660 CTGTTTTACAGCTGGAAAAACGG - Intronic
1047028099 8:120846672-120846694 CTGATTTACCTTAAAAAAAAAGG + Intergenic
1047862642 8:128985210-128985232 ATGCTATGCATTAGGAAAACAGG - Intergenic
1048024926 8:130577643-130577665 CTGCTTTTCAGTAGGTAAAAGGG + Intergenic
1048386592 8:133918030-133918052 CTGGTTTCCATTGGGAAACAGGG - Intergenic
1049315277 8:141962890-141962912 CAGTTTTACATTAGGGCAAACGG + Intergenic
1050212955 9:3284775-3284797 CTCCTTTATTTTAGGTAAAATGG + Intronic
1050655742 9:7826843-7826865 CTGCTTTCTAATATGAAAAAAGG - Intronic
1051071878 9:13179372-13179394 TTGCTTTTCATTAGCAAAAGAGG + Intronic
1052513367 9:29450302-29450324 ATGGTTTACATTAGCAAACACGG + Intergenic
1052598292 9:30591053-30591075 ATTCTTTAAATTAGGAAAATAGG - Intergenic
1055611146 9:78026035-78026057 CAGCTCTACTTTAGGAGAAATGG - Intronic
1055636869 9:78287588-78287610 CTGCTTTTCATGAGAAAACAAGG + Intergenic
1056183616 9:84109766-84109788 CTGGTTTAAAATAGAAAAAAAGG - Intergenic
1058736098 9:107895584-107895606 CTGTTTTACATTAGCTATAATGG - Intergenic
1059788285 9:117611144-117611166 CTGCCATACAATAGGAAAAGTGG + Intergenic
1060275425 9:122178882-122178904 CTGCCATCCATTAGGAGAAAGGG - Intronic
1060673009 9:125486825-125486847 CTGCTCTTCAGTAGGAAAACAGG - Intronic
1188402153 X:29758763-29758785 GTTTTTTACATTAGGAATAATGG - Intronic
1188468830 X:30514099-30514121 ATGTTTTACAATAGGAAAATTGG + Intergenic
1188562595 X:31486380-31486402 ATGCTGTAAATTGGGAAAAATGG + Intronic
1188639482 X:32482142-32482164 CTTCTTTACATTAAGAAATAAGG + Intronic
1189698146 X:43687021-43687043 ATGAATCACATTAGGAAAAACGG - Intronic
1190394229 X:49963570-49963592 TGGCCTTACATTTGGAAAAAGGG + Intronic
1191624200 X:63251354-63251376 GTGCTTTATATTATAAAAAAAGG - Intergenic
1191925347 X:66303233-66303255 GTCATTTATATTAGGAAAAAGGG - Intergenic
1193534124 X:82691822-82691844 CTGATTGACATCAGGGAAAAAGG + Intergenic
1193997707 X:88386864-88386886 CAGCTTTACATAATGATAAAGGG + Intergenic
1194640621 X:96399654-96399676 CTACTTTACATTAGGTAAAATGG - Intergenic
1195678253 X:107523883-107523905 CTGCTTCAAAAAAGGAAAAAAGG + Intronic
1195813741 X:108862611-108862633 ATGGTTTACATTGGGAAGAATGG - Intergenic
1196115207 X:111991830-111991852 CTCCTGTGTATTAGGAAAAATGG - Intronic
1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG + Intronic
1196788476 X:119442690-119442712 CTATTTTACAGTAGGCAAAATGG - Intronic
1197592409 X:128424644-128424666 TTCCTTCACATTAGGGAAAATGG - Intergenic
1197595694 X:128461419-128461441 CTGCTAGACATTAGGAGACAAGG - Intergenic
1197831465 X:130647525-130647547 CTGCATTACAGTAGAAAAATGGG - Intronic
1197999977 X:132423665-132423687 CTTTTTTTCATTAGGAAAAAAGG - Intronic
1198971878 X:142291103-142291125 CTGCATTTGCTTAGGAAAAAAGG - Intergenic
1201332775 Y:12845251-12845273 CTGCTTTATATTAGGGAAACTGG + Intronic
1201908082 Y:19105571-19105593 TTGCTTTTGATTAGGAAAAGTGG + Intergenic