ID: 986318578

View in Genome Browser
Species Human (GRCh38)
Location 5:6609054-6609076
Sequence AGAGCTCCAGCCTTTTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986318578 Original CRISPR AGAGCTCCAGCCTTTTTCTG GGG (reversed) Intronic
900493935 1:2967624-2967646 GGAGCTGCAGCCTTGTTCTCGGG + Intergenic
900726876 1:4222390-4222412 AGATTTCCTGACTTTTTCTGGGG - Intergenic
900938897 1:5784970-5784992 AGAGCCCCAGCCACTTTCAGGGG + Intergenic
901904253 1:12394056-12394078 AGACCTCCAGCCTTTTACCAGGG - Intronic
903266841 1:22162902-22162924 AGAGCTTCATCCACTTTCTGAGG - Intergenic
904773927 1:32895419-32895441 AGAGCTCCAGCCTGTGCCTCTGG - Exonic
905399118 1:37689092-37689114 AGAGCTCTAGCCTTTGTGTCAGG + Intronic
905465023 1:38146721-38146743 AGACCTCCAGCCTTTTACCAGGG + Intergenic
905891724 1:41522236-41522258 GGAGCTCCTGTCTGTTTCTGGGG - Intronic
905898234 1:41562953-41562975 AAACCTCCAGGCTTTCTCTGGGG - Intronic
906560073 1:46749835-46749857 CAAGCCCCAGGCTTTTTCTGGGG + Intergenic
908557117 1:65266858-65266880 AGATCCCCAGCCTTTTTCTAAGG + Intronic
908616430 1:65928096-65928118 AGACCTCCAGCCTTTTACCAGGG - Intronic
909028961 1:70516456-70516478 ATAACTCCATCCTTTTTTTGGGG + Intergenic
909803796 1:79849044-79849066 AGGGCTCCAGCATTTTTTTCTGG + Intergenic
910588022 1:88900355-88900377 AGACCTCCAGCCTTTTACCAGGG + Intergenic
911198141 1:95016769-95016791 AGCCTTCAAGCCTTTTTCTGAGG - Intronic
912130099 1:106589431-106589453 AGACCTCCAGCCTTTTACCAGGG - Intergenic
912775230 1:112502539-112502561 AGGCCTCCAGCCCTTCTCTGAGG - Intronic
914421258 1:147530201-147530223 ACAGCCCCAGCCTATCTCTGGGG + Intergenic
915667857 1:157461032-157461054 AGACCTCCAGCCTTTTACCAGGG - Intergenic
917217410 1:172692292-172692314 AGACCTCCAGCCTTTTACCAGGG - Intergenic
918918415 1:190673215-190673237 AGACCTCCAGCCTTTTACCAGGG - Intergenic
919068720 1:192726806-192726828 AGAGCTCTCTCCTTTCTCTGTGG - Intergenic
919413924 1:197282801-197282823 AAAGGTCCAACCTTTTTCAGAGG - Intronic
920215130 1:204357608-204357630 ACAGCTCCAACCTTCCTCTGGGG + Intronic
920362180 1:205426707-205426729 AGAGCTCCAGGATTTCCCTGAGG + Intronic
921941386 1:220843616-220843638 AGAGCCCCAGCCATTTGCTGAGG - Intergenic
922676526 1:227556086-227556108 ATATCTACAGTCTTTTTCTGTGG - Intergenic
1062972640 10:1660589-1660611 ACAAATCCACCCTTTTTCTGGGG - Intronic
1064226522 10:13490676-13490698 AGGCCTTCAGCCTTTATCTGTGG - Intronic
1064912021 10:20412832-20412854 AGAGCTCCATCACTTTTCTGTGG + Intergenic
1066167232 10:32800629-32800651 AGACCTCCAGCCTTTTACTAGGG - Intronic
1066551628 10:36564918-36564940 AGAGCGCCAGCCTCTCTCAGAGG - Intergenic
1069192501 10:65507748-65507770 AGACCTCCAGCCTTTTACCAGGG - Intergenic
1071860363 10:89666269-89666291 GGAGCACCTCCCTTTTTCTGTGG + Intergenic
1074577694 10:114685980-114686002 AGAGCTACAGCTATTTTCAGGGG + Intergenic
1076144247 10:128104539-128104561 AGAGCCTCAGCCTTTTCCTTAGG + Exonic
1078862470 11:15262455-15262477 AGAGCTCCAACTTTTTGCTGGGG - Intergenic
1079180899 11:18192638-18192660 ATATCTCCTGCCTTTTCCTGAGG - Intronic
1083688684 11:64393031-64393053 GGAGCTGCACCCTGTTTCTGTGG - Intergenic
1085736953 11:79047238-79047260 AGAGGTCCAGCATTGTTTTGTGG - Intronic
1086532306 11:87800698-87800720 AGAGCTCGAGCGCTGTTCTGGGG + Intergenic
1087147100 11:94823240-94823262 GGAGCTCCAGACCTTTTCAGTGG - Intronic
1087410936 11:97789547-97789569 AGACCTCTGGCCTTTTACTGGGG - Intergenic
1088264970 11:107980154-107980176 AGACCTCCAGCCTTTTACCAGGG + Intergenic
1088779092 11:113116591-113116613 AGAGCTTCTGGCTTTTTCTATGG + Intronic
1088905830 11:114155095-114155117 AGCTCTCCAGCCTTTTACTATGG + Intronic
1089495959 11:118908820-118908842 AGGGCTTCAGCCCTTGTCTGAGG - Intronic
1091832249 12:3558010-3558032 AGAGCCCCAGACATTTACTGGGG - Intronic
1096477531 12:51917537-51917559 AGGGCTCCAGCCATATCCTGAGG - Intronic
1098672854 12:73252845-73252867 AGACCTCCAGCCTTTTACCAGGG + Intergenic
1100266268 12:92979084-92979106 AGGGCTCCAGCTTTGTTCTTTGG - Intergenic
1100281709 12:93124714-93124736 AGGGCTCCAGCCTCCTTCTTGGG - Intergenic
1100445029 12:94651852-94651874 AGAAGTTCAGCCTTATTCTGTGG + Intergenic
1102031318 12:109741641-109741663 CTATCTCCAGCCTTTTACTGGGG - Intronic
1102045657 12:109828583-109828605 AGAGCTTAAGCCACTTTCTGAGG + Intronic
1102932543 12:116873814-116873836 AAAGCTCCTTCCTTTTCCTGTGG - Intronic
1103824197 12:123723051-123723073 AGAGCTCCAGCCTACTTCACAGG - Intronic
1109712865 13:66182299-66182321 AGACCTCCAGCCTTTTACCAGGG - Intergenic
1111045272 13:82805945-82805967 AGAGCTGCTGCATTTTGCTGGGG - Intergenic
1111235159 13:85400158-85400180 AGGGCTCCTGCAGTTTTCTGAGG + Intergenic
1115179076 14:30601168-30601190 AGGGCTCCAGCCTTTTTGTTGGG - Intronic
1117824360 14:59686819-59686841 AAAGCTGCAGACATTTTCTGAGG + Intronic
1119334742 14:73823561-73823583 GGAACTCCAGTCTTTGTCTGTGG - Intergenic
1119892063 14:78190254-78190276 AAAGTTCCAGGCTTTGTCTGTGG - Intergenic
1120231610 14:81846659-81846681 AGATCTCCAGCCTTTTACCAGGG - Intergenic
1120973472 14:90229061-90229083 AGACCTCCAGCCTTTTACCAAGG + Intergenic
1122182704 14:99967567-99967589 AGCACTCCAGCCTTCTGCTGGGG - Intergenic
1122603349 14:102932004-102932026 AGAACTCCTGCCTCTTCCTGGGG + Intronic
1123014034 14:105365103-105365125 GCAGCTCCAGCCCTTTGCTGAGG + Intronic
1127192540 15:56546279-56546301 AGTCCTCCAGTCTTTTTCTTTGG + Intergenic
1127310308 15:57746294-57746316 TGTGCTCCATCCTTTCTCTGCGG + Intronic
1127336684 15:57993018-57993040 ATAGCTCCAGCTTTGTGCTGTGG - Exonic
1129136132 15:73553693-73553715 AGAGCTGGAGCCTTCATCTGGGG - Intronic
1131270229 15:90942768-90942790 TGAGCTCCAGCTTTGTCCTGAGG - Intronic
1131373002 15:91899141-91899163 AGAGTTCCAGAATGTTTCTGGGG - Intronic
1133845077 16:9446170-9446192 ATATCTCCAGCCTTTGTCTTGGG - Intergenic
1133965552 16:10528923-10528945 AGAGCGCCAGCCTGTTCATGAGG + Exonic
1134492092 16:14703120-14703142 TGAGCTCTTGCATTTTTCTGGGG + Intergenic
1134497473 16:14742242-14742264 TGAGCTCTTGCATTTTTCTGGGG + Intronic
1136153127 16:28365090-28365112 TGAGCTCTTGCCTTTTTCTGGGG - Intergenic
1136209958 16:28750183-28750205 TGAGCTCTTGCCTTTTTCTGGGG + Intergenic
1136358858 16:29764631-29764653 ACAGTTCCAGCCTTCTTCAGGGG + Intergenic
1136392837 16:29976199-29976221 AGAGCACCTGCCTTTGTGTGTGG + Intronic
1138625033 16:58244770-58244792 ATGCCTCCAGCCTCTTTCTGTGG + Intronic
1139015282 16:62682822-62682844 AGAGCTCCTGCCTTTTTGCTTGG - Intergenic
1140669988 16:77268987-77269009 AGAGCTCCTGCAGTTTGCTGGGG + Intronic
1141387064 16:83631522-83631544 AGAACTCCATCATTTTGCTGTGG - Intronic
1141399743 16:83737043-83737065 TGAGCTCCCACCCTTTTCTGCGG - Intronic
1143974238 17:10818431-10818453 AGAACACCAGCCGTCTTCTGTGG + Intergenic
1144263315 17:13544544-13544566 ACAGCCCCAGCCTCTTTGTGTGG + Intronic
1144503516 17:15809498-15809520 AGAGCTCCAGCCATGTTCACTGG - Intergenic
1145166562 17:20617210-20617232 AGAGCTCCAGCCATGTTCACTGG - Intergenic
1146193650 17:30792458-30792480 AGAGCTCCGACTTATTTCTGTGG - Exonic
1146850741 17:36219629-36219651 AGACCTCCAGCCTTTTACCAGGG + Intronic
1147955346 17:44130562-44130584 AGAGCTTTAGCCTTCTTCTCTGG + Intergenic
1148194032 17:45700401-45700423 AGAGCACCTGGCTTTTCCTGTGG + Intergenic
1149000311 17:51750665-51750687 AGAGATCCAGCCCTGCTCTGTGG - Intronic
1149609986 17:57953154-57953176 AGAGCTCCAGCTTGTTCTTGGGG - Intronic
1150205937 17:63407413-63407435 AGAGTTCCTGCCTCTTTCAGTGG - Intronic
1151157235 17:72133812-72133834 ACACCTCCAGCCTCTTTCTGTGG + Intergenic
1153131470 18:1859124-1859146 AGACCTCCAGCCTTTTGCCAGGG - Intergenic
1154249423 18:12731109-12731131 AGAGGTACAGCCTTGCTCTGGGG + Intergenic
1156088452 18:33437760-33437782 TGAGCTTCAGCCTTTTGCTGCGG + Intronic
1157273659 18:46294961-46294983 AGGTCTCCAGCCCTTGTCTGGGG + Intergenic
1158411658 18:57210958-57210980 AAGGCTCCAGGCTTTTTCTGTGG + Intergenic
1158436708 18:57439444-57439466 AGAGCTTTAGCCTTTTTATCTGG + Intronic
1158535781 18:58307021-58307043 AAAGCTCCAGCTTTACTCTGGGG - Intronic
1160825852 19:1080329-1080351 AGTGCACCCGCCTTCTTCTGGGG - Exonic
1161391044 19:4020381-4020403 TGAGCTCCAGCCTTTACCAGGGG + Intronic
1164514713 19:28924012-28924034 AGAGCTCCTGGCTTTCTGTGGGG - Intergenic
1166688525 19:44809731-44809753 GGTGCTCCAGCCCTTTCCTGAGG - Intronic
1168087004 19:54055515-54055537 AGATCTCCAGCTTGTTGCTGGGG + Intronic
926810582 2:16752077-16752099 AGACCTCCAGCCTTTTACCAGGG - Intergenic
926826586 2:16912285-16912307 AGACCTCCAGCCTTTTACCAGGG + Intergenic
928680910 2:33701078-33701100 AGGCCTCCAGCTTTGTTCTGTGG - Intergenic
929979959 2:46669064-46669086 GGAGCAGCAGCCATTTTCTGGGG - Intergenic
932846538 2:75141279-75141301 AAAACTCCAGCTATTTTCTGAGG - Intronic
933265911 2:80180122-80180144 AGATCTCCAGCCTTTTACCAGGG - Intronic
933338934 2:80997165-80997187 ACAGCTCCAGGCTTATTTTGTGG + Intergenic
933863819 2:86498007-86498029 TGAGCTCCAGCGTTTCTGTGTGG + Intergenic
935550496 2:104448170-104448192 AGAGCTACATCCTTTTGCTTTGG + Intergenic
936016638 2:108964256-108964278 AGAGATCCAGGACTTTTCTGAGG + Intronic
937800142 2:126073340-126073362 AGACCTCCAGCCTTTTATCGGGG + Intergenic
937852757 2:126650129-126650151 AGACCTCCAGCCTTTTACCAGGG - Intergenic
938675830 2:133632991-133633013 AGAGCACCTGCCTTTTCCTTTGG + Intergenic
938694002 2:133818849-133818871 AGAGCTAAGGCCTTGTTCTGAGG - Intergenic
939068881 2:137516451-137516473 AGACCTCCAGCCTTTTACCAGGG + Intronic
939213634 2:139210514-139210536 AGACTTCCAGCCTTTTACTAGGG + Intergenic
941010244 2:160291569-160291591 AGAGCTACAGCTTTTCTCTGTGG + Intronic
942789998 2:179750158-179750180 AGAGCTCCAGCCGTTTTCAATGG - Intronic
943006385 2:182392082-182392104 AGACATCCAGCCTTTTACTAGGG + Intronic
943239394 2:185363992-185364014 AGATCTCCAGCCTTTTACCAGGG - Intergenic
944208984 2:197186903-197186925 AAAGCTCCAGACTGTTTCTCAGG - Intronic
945419293 2:209615173-209615195 AGAGCACCAGGCTATTTTTGAGG - Intronic
946053768 2:216884159-216884181 AGGGCTCCAGCCTTTGCCTCTGG - Intergenic
946079783 2:217107605-217107627 ATAGCAGCAGCCTCTTTCTGTGG - Intergenic
946620664 2:221559349-221559371 AGAGCTCCAGATTTTCTCTTTGG - Intronic
1168814191 20:725453-725475 TGAGCTCCAGGCTTTGGCTGGGG - Intergenic
1170149566 20:13215635-13215657 ACCGCTCCAGCCTTGTTCTGGGG + Intergenic
1170255960 20:14343337-14343359 AGAGCTCCAGTTATTTTCTCAGG - Intronic
1172321682 20:33999832-33999854 TGTGCTCCAGTCTTTTTCTCGGG + Intronic
1172661159 20:36570049-36570071 AGAGCTCCAGCTGGTTCCTGCGG - Intergenic
1174163388 20:48567532-48567554 GGAGCTGCAGCCTGTGTCTGGGG - Intergenic
1176028761 20:63000107-63000129 AGAGGTGCAGACATTTTCTGAGG + Intergenic
1177220306 21:18183777-18183799 AGAGTTCCAACCTTACTCTGTGG - Intronic
1179495701 21:41770054-41770076 GGGGCTCCAGCTTTATTCTGGGG - Intergenic
1179560674 21:42214212-42214234 AGAGCTCCACCCTATTCATGAGG - Intronic
1179910486 21:44444817-44444839 AGAGCTCCAGCAGCCTTCTGGGG + Intergenic
1180869533 22:19138418-19138440 AGAGCCCCAGCCTTGCCCTGAGG - Intronic
1181780189 22:25186888-25186910 AGGGCTCCAGCATTTCTCTGTGG + Intronic
1181789899 22:25257015-25257037 AGGGCTTCAGGATTTTTCTGGGG - Intergenic
1182526706 22:30924978-30925000 AGAACTCCAGTCTGTTTCTGTGG + Intergenic
950765463 3:15269904-15269926 GGAGCCCCTGCCATTTTCTGAGG - Intronic
951003430 3:17591432-17591454 AGACCTCCAGCCTTTTACCAGGG + Intronic
951862734 3:27272209-27272231 AAAGTCCCAGCCTTTGTCTGGGG + Intronic
954853263 3:53621027-53621049 AGAGCTTCAGGCTGTGTCTGAGG - Intronic
955035397 3:55262692-55262714 AGACCTCCAGCCTTTTACCAGGG + Intergenic
955347339 3:58170836-58170858 AGCCCTCCAGCCTGTTTGTGGGG + Intronic
957026814 3:75191868-75191890 AGAGTTCCAGCTATTCTCTGGGG + Intergenic
958173962 3:89971853-89971875 ACTTCTCCAGCCATTTTCTGAGG + Intergenic
961452847 3:127010219-127010241 GGACCTCCAGCCTTTTACCGGGG + Intronic
962343335 3:134602794-134602816 AGAGCTGCAGCCTTGGTCTGAGG - Intronic
965251698 3:166351215-166351237 AGACCTCCAGCCTTTTTCCAGGG - Intergenic
966303750 3:178507871-178507893 AGAGCTCTGGACTTTTTCAGTGG - Intronic
967913931 3:194564156-194564178 TGAGGTCCAGACTTTTGCTGAGG - Intergenic
967968738 3:194984175-194984197 GGGGCTCCAGCCTTCTCCTGAGG + Intergenic
968001475 3:195209652-195209674 TGTGCTGCAGCCTTTTTCTCTGG - Intronic
968042269 3:195598744-195598766 AGAGGACCAGCCTCCTTCTGAGG - Intergenic
969498698 4:7540362-7540384 AGGACCCCAGCCTTCTTCTGTGG + Intronic
969920615 4:10536141-10536163 ACAGCTGCAGCCTTTTGCAGTGG - Intronic
970454120 4:16205085-16205107 AAAACGCCAGCCTCTTTCTGTGG + Intronic
972002129 4:34050833-34050855 ATAGCTCCAGCCTTTAAATGTGG - Intergenic
972704479 4:41528461-41528483 AGAGATGCAGCCTTTGTGTGAGG + Intronic
974680452 4:65154520-65154542 AGGGCTCAAGGCTTTTTCAGTGG + Intergenic
974768759 4:66383410-66383432 AGGGCTGCAGCAGTTTTCTGGGG - Intergenic
975901705 4:79161289-79161311 AGGGCTCCAGGATTCTTCTGAGG - Intergenic
976597103 4:86904706-86904728 AGAGATGCGGCCTTTTTATGCGG - Intronic
978102587 4:104860731-104860753 AGAACTGCAGCCTTTTTCTCTGG + Intergenic
981142086 4:141280516-141280538 AGGACTTCAGCCTTTTTATGGGG - Intergenic
981760846 4:148192914-148192936 AGAACTAAAGCCCTTTTCTGTGG - Intronic
981797791 4:148616889-148616911 AGAGATCCAGACATTTTCAGAGG + Intergenic
985870139 5:2548018-2548040 AGACCTCCAGGCTCTTTTTGGGG - Intergenic
986318578 5:6609054-6609076 AGAGCTCCAGCCTTTTTCTGGGG - Intronic
986959640 5:13197791-13197813 AGACCTCTAGCCTTTTACTAGGG + Intergenic
987023552 5:13899938-13899960 AGAGATCGTGCCTTTTTCAGTGG + Intronic
989140704 5:38198679-38198701 AGCCCTCCAGCCATTTTCTTTGG - Intergenic
990210331 5:53476976-53476998 AGAGATCCATCCCATTTCTGTGG - Intergenic
990277557 5:54214404-54214426 AAAGCTCCAGCATTTTTCAAAGG - Intronic
991043397 5:62197914-62197936 AAGTCTCCAGCCTTTTCCTGAGG - Intergenic
991971580 5:72146840-72146862 ATAGCATCAGCCTCTTTCTGGGG + Intronic
992980218 5:82162444-82162466 ATTGATACAGCCTTTTTCTGAGG + Intronic
994451316 5:99948672-99948694 AGAACTCCAACTTATTTCTGTGG - Intergenic
995269750 5:110206867-110206889 AGACCTCCAGCCTTTTACCAGGG - Intergenic
995689367 5:114806379-114806401 TGAGCTCCCACCTTTTTCTCTGG - Intergenic
998658041 5:144204612-144204634 ATACCTGCAACCTTTTTCTGGGG - Intronic
999734835 5:154505518-154505540 TGAGCTCCAGCTGTTTTCTGTGG - Intergenic
1002917315 6:1539821-1539843 AGAGCACCCGCCATTTTATGGGG + Intergenic
1003243441 6:4364431-4364453 GTATCTCCAGGCTTTTTCTGTGG + Intergenic
1003758419 6:9148677-9148699 AGACCTCCAGCCTTTTACCAGGG + Intergenic
1006062151 6:31431754-31431776 AGACCTCCAGCCTTTTACCAGGG + Intergenic
1006300632 6:33192111-33192133 AGAGCTCCAGCCTGACTCCGAGG + Intronic
1006843549 6:37047521-37047543 AGAGCTGCAGCCTGGCTCTGAGG + Intergenic
1007337157 6:41162156-41162178 AGAGCACCAGCCTGTTGCTGGGG + Intronic
1007720261 6:43880958-43880980 ATAGCTCCAGCCTGGTTCTGGGG + Intergenic
1008400101 6:51054088-51054110 AGATCTCCAGCCTTTTACCAGGG + Intergenic
1009390301 6:63136486-63136508 AGACCTCCAGCCTTTTACAAGGG - Intergenic
1009806307 6:68605543-68605565 AGACCTCCAGCCTTTTACCAGGG + Intergenic
1010108188 6:72192326-72192348 AGACCTCCAGCCTTTTACCAGGG - Intronic
1010326833 6:74574034-74574056 AGAGGTCCAGACATTTTTTGTGG + Intergenic
1010818436 6:80386994-80387016 AGACCTCCAGCCTTTTACAAGGG + Intergenic
1011232735 6:85181014-85181036 AAAGCTCCAGTCTATTGCTGAGG - Intergenic
1012730273 6:102872912-102872934 AGACCTCCGGCCTTTTACTGGGG + Intergenic
1013988589 6:116226505-116226527 AAAACTCCACCCTTTTTCTCAGG - Intronic
1014534395 6:122598028-122598050 AGACCTCCAGCCTTTTACCAGGG - Intronic
1016045627 6:139477613-139477635 GGAGCTCCTGCCTCTTTCTTGGG + Intergenic
1017500904 6:155021938-155021960 TGACCTCCTGCCTCTTTCTGCGG + Intronic
1018966680 6:168495413-168495435 AGAGCTCCAACATTTTCCTTGGG + Intronic
1019002939 6:168770679-168770701 AGACCTCCAGCCTTTTACTGGGG + Intergenic
1019125567 6:169838210-169838232 AGAAATCCAGCCTTCTTCTGGGG + Intergenic
1022195547 7:28063158-28063180 AAAAGTCCAGCCCTTTTCTGTGG - Intronic
1022945794 7:35282194-35282216 AGAGCACCATCCTGTCTCTGGGG + Intergenic
1024040074 7:45546106-45546128 AGACCTCCAGCCTTTTACCAAGG - Intergenic
1026425221 7:70284851-70284873 AGAGGTCCAGGATTGTTCTGAGG + Intronic
1026534676 7:71229889-71229911 AGAGCGGCAGCCTGTGTCTGTGG + Intronic
1027838561 7:83278497-83278519 AAAGCTCCAGCTGTTTTCAGTGG + Intergenic
1030021087 7:105275953-105275975 AGAGCTACATCCTTTTTCAATGG + Intronic
1033228987 7:139582225-139582247 AGGGCTCCAGCCTGCTTCTCTGG + Intronic
1034045619 7:147924067-147924089 ACAGCTCCAGGCATTTGCTGAGG + Intronic
1034108606 7:148514335-148514357 AGAGATCCAGCCTTACTCTGAGG + Intergenic
1035297249 7:157874139-157874161 CTAGCTCCAGCCTTGTCCTGCGG + Intronic
1036068082 8:5406433-5406455 AAATCTACAGCCTTTTACTGGGG - Intergenic
1036204739 8:6796850-6796872 TGAGCACCAGCCTTGTTCTCAGG + Intergenic
1036581049 8:10076402-10076424 TGAGCTCCAGCCTTCTTTTTGGG + Intronic
1038917132 8:32037194-32037216 AGGGCTGCAGCCATTTGCTGGGG + Intronic
1039330434 8:36531491-36531513 AGACCTCCAGCCTTTTACCAGGG + Intergenic
1040916313 8:52569189-52569211 AGACCTCCAGCCTTTTACCAGGG - Intergenic
1041054729 8:53972694-53972716 AGAGGTCCAGTCCTTTTTTGGGG - Intronic
1042001248 8:64125390-64125412 AGACCTCCAGCCTTTTACCAGGG - Intergenic
1042390199 8:68225655-68225677 AGTGCTCCAACCATTTTCAGGGG - Intronic
1043710563 8:83412110-83412132 AGATTTCCATCCTTTTTCTATGG + Intergenic
1044633610 8:94301190-94301212 AGACCTCCAGCCTTTTACCAAGG - Intergenic
1044880185 8:96715638-96715660 AGAGCTGCAGACTTTCCCTGTGG + Intronic
1045656078 8:104387889-104387911 AAAGCACCTGCCTATTTCTGTGG + Intronic
1046128860 8:109943008-109943030 AGACCTCCAGCCTTTTACCAGGG - Intergenic
1049434986 8:142582332-142582354 AGCCCTCCAGCCTCTTCCTGGGG - Intergenic
1049474120 8:142789030-142789052 AGAGCTCCAGGCACGTTCTGGGG + Intergenic
1050684182 9:8148122-8148144 AGACCTGCAGCTTTTTTCTCTGG - Intergenic
1052227415 9:26106962-26106984 AGACCTCCAGCCTTTTACCAGGG + Intronic
1053317936 9:37068391-37068413 AGTGCTTCATTCTTTTTCTGGGG - Intergenic
1054822552 9:69538036-69538058 AAGGCTCCAGCCTTTTTCAATGG - Intronic
1056037171 9:82618953-82618975 ATAGCTCCAGCCTAATTTTGAGG - Intergenic
1056072454 9:83001918-83001940 GGAGTTCCAGCCTTTATCTGAGG - Intronic
1056433673 9:86554217-86554239 AGAGGTGGAGCCTTTCTCTGTGG + Intergenic
1057137030 9:92698819-92698841 AGACCTGCAGCCTTTTTCTCTGG + Intergenic
1057497158 9:95570372-95570394 AGAGCGCCTGCATTTTTTTGCGG + Intergenic
1057989585 9:99754415-99754437 AGAGCAAAAGCCTATTTCTGTGG + Intergenic
1061787947 9:133042098-133042120 ACAGCTCCAGCCTCTTGGTGGGG - Exonic
1062042917 9:134412342-134412364 TCAGCTCCAGCCTGTTTCTAGGG - Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1186448917 X:9655814-9655836 AGAGCTCGAGCCATTCTGTGTGG - Intronic
1187604695 X:20870658-20870680 AGACCTCCAGCCTTTTACCAAGG + Intergenic
1189866664 X:45337177-45337199 GGCTCTCCAGCCTTTTTTTGTGG + Intergenic
1190039685 X:47060135-47060157 ATGGCTCCAGCCTTTTTGTTTGG - Exonic
1190970257 X:55341706-55341728 TGAGCTCCAGCTTCTTCCTGTGG - Intergenic
1191946178 X:66537604-66537626 AGACCTCCAGCCTTTTACCAGGG + Intergenic
1191970892 X:66815194-66815216 AGAGCTCCAGGCTGGTACTGGGG + Intergenic
1191988368 X:67006041-67006063 AGACCTCCAGCCTTTTACCAAGG - Intergenic
1192188691 X:68977252-68977274 AGAGCCACAGTTTTTTTCTGTGG + Intergenic
1192228515 X:69246535-69246557 AGAGCTCGAGCATTGTGCTGGGG - Intergenic
1192299640 X:69886433-69886455 AAGTCTTCAGCCTTTTTCTGGGG - Intronic
1193877101 X:86873904-86873926 ATACCTCCAGCCTTTTACTAGGG + Intergenic
1194343131 X:92729692-92729714 AGACCTCCAGCCTTTTACCAGGG + Intergenic
1195809850 X:108817230-108817252 AGACCTCTAGCCTTTTACCGGGG - Intergenic
1196481803 X:116158740-116158762 AGGTCTCCAGACTTTTTGTGAGG - Intergenic
1197046379 X:122003603-122003625 AGGGCTCCTGCAGTTTTCTGGGG + Intergenic
1197591677 X:128417935-128417957 AGACCTCCAGCCTTTTGCGAGGG + Intergenic
1197729163 X:129795411-129795433 GGAGCTTGAGCCTTGTTCTGAGG - Intergenic
1199310598 X:146315672-146315694 AGACCTCCAGCCTTTTACCAGGG - Intergenic
1200651489 Y:5846358-5846380 AGACCTCCAGCCTTTTACCAGGG + Intergenic