ID: 986318614

View in Genome Browser
Species Human (GRCh38)
Location 5:6609364-6609386
Sequence CTGGCTAGAAAGATGCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986318614_986318623 24 Left 986318614 5:6609364-6609386 CCGGGCTGCATCTTTCTAGCCAG 0: 1
1: 0
2: 2
3: 17
4: 193
Right 986318623 5:6609411-6609433 CTTGCAGCCAAGGTGAACCCGGG 0: 1
1: 0
2: 0
3: 12
4: 104
986318614_986318622 23 Left 986318614 5:6609364-6609386 CCGGGCTGCATCTTTCTAGCCAG 0: 1
1: 0
2: 2
3: 17
4: 193
Right 986318622 5:6609410-6609432 CCTTGCAGCCAAGGTGAACCCGG 0: 1
1: 0
2: 0
3: 11
4: 147
986318614_986318624 28 Left 986318614 5:6609364-6609386 CCGGGCTGCATCTTTCTAGCCAG 0: 1
1: 0
2: 2
3: 17
4: 193
Right 986318624 5:6609415-6609437 CAGCCAAGGTGAACCCGGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 104
986318614_986318620 14 Left 986318614 5:6609364-6609386 CCGGGCTGCATCTTTCTAGCCAG 0: 1
1: 0
2: 2
3: 17
4: 193
Right 986318620 5:6609401-6609423 GTCATCATTCCTTGCAGCCAAGG 0: 1
1: 0
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986318614 Original CRISPR CTGGCTAGAAAGATGCAGCC CGG (reversed) Intronic
900768205 1:4519652-4519674 ATGGCCAGGAAGATGCAGCATGG + Intergenic
901388594 1:8927582-8927604 CTGACTATAAAGGAGCAGCCCGG + Intergenic
904136177 1:28314272-28314294 CTGGACAGAAAGGTGGAGCCTGG + Intergenic
905616304 1:39402567-39402589 CTGGCTAGAAAGATAGCACCAGG + Intronic
907050318 1:51325849-51325871 CTGGAGAGAAAGATCCAGGCCGG + Intronic
908918579 1:69162517-69162539 CTTGGTAGAAAAATGCAACCAGG + Intergenic
908982537 1:69976321-69976343 CATGGGAGAAAGATGCAGCCTGG + Intronic
910277724 1:85466041-85466063 CTGGCAAGAAGGCTGTAGCCTGG - Intronic
910428556 1:87139330-87139352 AGGGGTAGGAAGATGCAGCCAGG + Intronic
912383478 1:109260047-109260069 CTGGGCAGGAAGATGCAGCGGGG - Intronic
916611503 1:166396516-166396538 CTGGCTACAGAGATGTAGACAGG + Intergenic
919382318 1:196874466-196874488 ATGGGTAGACAAATGCAGCCAGG + Intronic
919770931 1:201158111-201158133 CTGGCTTCAAAGATGCAGGCAGG + Intronic
920235404 1:204500057-204500079 CTGGCTTGAAAGTTGAAGCATGG + Intergenic
1063598137 10:7455991-7456013 CTGACCAGATAGAAGCAGCCAGG + Intergenic
1063889873 10:10618283-10618305 CTGGATGGGAAGAAGCAGCCTGG - Intergenic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1069375467 10:67788560-67788582 CTGGCGAGAAGGAAGCTGCCAGG + Intergenic
1069408091 10:68123482-68123504 CTGGCTAAAAAGGTGAAACCCGG + Intronic
1069914793 10:71780815-71780837 CAGGCTAGAATGAGGTAGCCGGG + Intronic
1070384993 10:75916383-75916405 CTGGCAAGAGAGAGGCAGCAGGG + Intronic
1070638292 10:78146833-78146855 CAGGCTAGAATGATTCAGACTGG + Intergenic
1070912853 10:80133278-80133300 CTGGCAAGAGAGAAGGAGCCAGG + Intronic
1071520379 10:86328517-86328539 CTGGCAAGATAAATGCTGCCAGG - Intronic
1072789592 10:98308627-98308649 GTGGTTGGCAAGATGCAGCCAGG + Intergenic
1073139266 10:101236877-101236899 CTGGCCAGGACGAAGCAGCCCGG - Intergenic
1074850246 10:117433658-117433680 GTGGCTGGAAGGCTGCAGCCAGG - Intergenic
1076678035 10:132158104-132158126 CTGAGTAGACAGATGCTGCCGGG - Intronic
1076739867 10:132477832-132477854 CTCGCTAGCCAGAGGCAGCCTGG + Intergenic
1077265176 11:1645076-1645098 CTGGCCAGAGAGATGGAGCAGGG - Intergenic
1077385615 11:2268262-2268284 CTGGCTTGGAAGCTGCAGGCTGG - Intergenic
1078469560 11:11576161-11576183 CTGGCTAGAGAAGGGCAGCCTGG - Intronic
1078694921 11:13621116-13621138 ATGGCTAACTAGATGCAGCCAGG - Intergenic
1081460465 11:43268154-43268176 CTGGCTGGAAGGCTACAGCCTGG + Intergenic
1081584281 11:44373669-44373691 CTGGATAGAAAGCTGCGGGCTGG + Intergenic
1082861193 11:57858220-57858242 CTGAGGAGAAAGATGGAGCCTGG + Intergenic
1084287796 11:68142995-68143017 CTGGCCAATGAGATGCAGCCTGG - Intergenic
1084360313 11:68664816-68664838 CTGGCAGGACAGAAGCAGCCAGG + Intergenic
1084958971 11:72706269-72706291 CTGGGTAGAAAGATGAAGGAGGG - Intronic
1086496827 11:87412600-87412622 ATGGCTGAACAGATGCAGCCAGG + Intergenic
1087841695 11:102927402-102927424 CTGGCTAGACATATACAGTCTGG - Intergenic
1087873507 11:103327257-103327279 ATGGCTAACTAGATGCAGCCAGG - Intronic
1088373491 11:109116472-109116494 CTGCCTACAAAGAGGCAGCTAGG - Intergenic
1088921042 11:114259910-114259932 CAGGGTGGAGAGATGCAGCCTGG + Intronic
1090554987 11:127864499-127864521 CTGGTTAGAAATATGTAGCCAGG - Intergenic
1091058075 11:132437360-132437382 CTGGGAAGAAAGAAGCAGACAGG + Intronic
1096579121 12:52573204-52573226 GTGGCTGGAAAGGTGCAGCTGGG - Intronic
1096896389 12:54824388-54824410 CTGGCTAGCACGATGAAACCCGG - Intergenic
1097372033 12:58796008-58796030 CTGTCTAGAAAAATGCTGACTGG + Intronic
1099501174 12:83415681-83415703 ATGGCCAGCTAGATGCAGCCAGG - Intergenic
1102395842 12:112585113-112585135 CAGGGGAGAAAGATGCAGGCTGG + Intronic
1103056179 12:117822751-117822773 CGGGCTAGCAATATGCAGCATGG - Intronic
1104858532 12:131913016-131913038 CTGGCAGGGAGGATGCAGCCTGG + Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105957951 13:25301675-25301697 CGGGCGAGAGAGATGCTGCCCGG + Exonic
1107572892 13:41681954-41681976 TTGGCTTAAAAGATGCAGCGTGG - Intronic
1108044053 13:46366204-46366226 CTGGTTGGTCAGATGCAGCCAGG - Intronic
1108825077 13:54403545-54403567 CAGGGGAGAAAGATGCAGGCTGG - Intergenic
1109449011 13:62484031-62484053 CTGGAAAGAAAGGAGCAGCCAGG - Intergenic
1114046557 14:18881191-18881213 CTGGCAAGAGAGAAGGAGCCAGG + Intergenic
1114117655 14:19638257-19638279 CTGGCAAGAGAGAAGGAGCCAGG - Intergenic
1115406431 14:33022072-33022094 GAGGCTACAGAGATGCAGCCTGG - Intronic
1116848407 14:49885593-49885615 CTGGCGAGAAGGAGGCAGGCTGG - Intergenic
1118478426 14:66140830-66140852 ATGGCCAAAAAGCTGCAGCCAGG + Intergenic
1124205239 15:27712932-27712954 CTGGCTATAAAGATGGAGGAGGG + Intergenic
1124840059 15:33233244-33233266 CTGGCTAGAAAGCAGCAGCTTGG - Intergenic
1127968927 15:63944149-63944171 CTGGATAAAAGGATGAAGCCTGG + Intronic
1130104959 15:80922148-80922170 CTGGCCAGAGAGGCGCAGCCTGG - Intronic
1132774664 16:1586405-1586427 CTGGGCAGAAAGATGCAGCCAGG - Intronic
1135481069 16:22821039-22821061 CTGGCTACAGAGATGAAGCAGGG - Intronic
1137770212 16:51010349-51010371 CTGAATGGAAAGATGTAGCCTGG + Intergenic
1139308656 16:66009571-66009593 ATGGCTAACTAGATGCAGCCAGG + Intergenic
1140710385 16:77672107-77672129 CAGGGTAGAAAGATGAAGGCTGG - Intergenic
1140939085 16:79704231-79704253 CTGGCTAGAGACTTGTAGCCTGG - Intergenic
1141012163 16:80412809-80412831 CTGGGTCGTAAGATGCAGCAAGG - Intergenic
1141389155 16:83649867-83649889 CTGGTTAGAAAGGTACAACCTGG - Intronic
1142610776 17:1108431-1108453 CTGGCTTGGAGGCTGCAGCCAGG - Intronic
1143107223 17:4535868-4535890 CTGGCAGGAGAGAAGCAGCCAGG + Intronic
1143684637 17:8504078-8504100 CTGGGTAGAAAGCTGCAGTGTGG - Intronic
1146823023 17:35999854-35999876 CTAAATAGAAAAATGCAGCCAGG + Intronic
1146968363 17:37052324-37052346 CCAGTTAGGAAGATGCAGCCGGG + Intronic
1148262152 17:46193234-46193256 CCGGCTGGAAAGAGGCGGCCGGG - Intronic
1148435704 17:47682837-47682859 CTGAGGAGAAAGATGGAGCCTGG + Exonic
1148819561 17:50352800-50352822 CTGGCTTGAAAGCTGAAGCAGGG - Intronic
1150338380 17:64346118-64346140 CTGGCTAGGTGGATGCAGCCTGG + Intronic
1151786372 17:76276985-76277007 CTGGGAAGAAAGATTCACCCCGG - Intronic
1151886749 17:76927093-76927115 CTGGGTAGAAAGGAGCAGGCAGG + Intronic
1151892716 17:76960161-76960183 CTGGCTCTAAAGATGCAGGAAGG - Intergenic
1153764634 18:8363851-8363873 CTGTAAAGAAACATGCAGCCTGG - Intronic
1153809019 18:8735475-8735497 ATGGCTTGAAAAAGGCAGCCAGG - Intronic
1154207765 18:12352325-12352347 CTGGCTTCAATGATGAAGCCAGG - Intronic
1156428094 18:37037907-37037929 CTGGCTAGCACGGTGAAGCCTGG + Intronic
1156888001 18:42157954-42157976 CTGGCTAGAGAGAAGCAGTGGGG - Intergenic
1158624145 18:59057167-59057189 CTGGCCAGAAAGGGGCAGGCTGG - Intergenic
1160704951 19:525262-525284 CTGGCCAGTGAGATGCAGCCGGG + Intergenic
1162991533 19:14305809-14305831 CAGGCTAGGAAGATGCAGCAGGG + Intergenic
1164424057 19:28124528-28124550 CTGTCCAGACAGATGCAGCAAGG - Intergenic
1165069372 19:33246984-33247006 CCACCCAGAAAGATGCAGCCAGG - Intergenic
1165326161 19:35115660-35115682 CTGGCTAGGAAACTGCAGCCTGG + Intergenic
1165647566 19:37455588-37455610 CTGCCTTGAGAGATGCTGCCAGG - Intronic
926319238 2:11736946-11736968 CTGGGAAGAAGGATGAAGCCTGG + Intronic
928198320 2:29230571-29230593 CTTGCTAGAAAGAGGAAGCCAGG + Intronic
929129510 2:38553293-38553315 CTGGCCAGAAATATTCAGGCAGG + Intergenic
930087146 2:47505736-47505758 CTGGGGAGAGAGATGAAGCCGGG + Intronic
931552544 2:63462637-63462659 CTGGCTAAAAATATGCAGAAAGG + Intronic
932285574 2:70529034-70529056 CTGGCAACAAAGATAAAGCCAGG - Intronic
933945651 2:87284056-87284078 ACACCTAGAAAGATGCAGCCCGG + Intergenic
937050292 2:118882935-118882957 CTCGCTAGAAAGCTGCACACAGG - Intergenic
940809341 2:158224605-158224627 CTGGCTTGAGAGTTTCAGCCAGG - Intronic
942397759 2:175569527-175569549 CAGGCTAGAAAGAGGCAGAATGG - Intergenic
942542674 2:177031079-177031101 GCGGCTAGTTAGATGCAGCCTGG - Intergenic
943759458 2:191592521-191592543 CTGGCTTTAAAGATGGAGCAAGG - Intergenic
944101136 2:196029356-196029378 CTGCCTAGAAAGATGCATCAGGG + Intronic
944464954 2:199991714-199991736 CTGGGGACAAAGAGGCAGCCAGG - Intronic
946140762 2:217688661-217688683 CTGGCTGGATATTTGCAGCCTGG + Intronic
1170843701 20:19944547-19944569 ATGGCAAGAAAGATACACCCTGG - Intronic
1177900974 21:26914677-26914699 CTGGCTAGGAAGATGAAGAAAGG - Intergenic
1180465095 22:15603829-15603851 CTGGCAAGAGAGAAGGAGCCAGG + Intergenic
1181019908 22:20094294-20094316 GTGGGTGGAGAGATGCAGCCAGG - Intronic
1182305664 22:29366124-29366146 CTGGCCAGAAAGATGCTTACAGG + Intronic
1182312939 22:29422062-29422084 CTGGCCAGAAAGATGCTTACAGG + Intronic
1184989262 22:48156134-48156156 CTGGCCAGGAAGTTGCAGCGAGG + Intergenic
1185376604 22:50485487-50485509 CTGGCCAGAGGGATGCAGACAGG - Exonic
950549596 3:13658120-13658142 CTGGGTACAAAGAAGCAGCAAGG - Intergenic
950692971 3:14675560-14675582 GTGACTATATAGATGCAGCCTGG - Intronic
954020031 3:47731947-47731969 CTGGCTTAAAAGCTTCAGCCAGG - Intronic
954029758 3:47810674-47810696 CTGGCCAGAAATGTTCAGCCTGG + Exonic
954106565 3:48412714-48412736 CAGGCCAGGAAGATGCAGCTGGG + Intronic
954307337 3:49735620-49735642 CTTGCATGAAAGATGCAGACTGG + Intronic
955943353 3:64167650-64167672 CTGGGCAGAAAGATGGAGGCTGG + Intronic
956216267 3:66852584-66852606 CTGGCTAGAATAAAGCAGGCAGG - Intergenic
956638871 3:71395459-71395481 ATGGCAAGAAGGAGGCAGCCAGG - Intronic
959000171 3:100955149-100955171 CATGCTAGAAATATGCAGCTGGG - Intronic
959881338 3:111447895-111447917 ATGGCTGAATAGATGCAGCCAGG + Intronic
960374447 3:116881207-116881229 CTGGTAATAAAGATACAGCCAGG + Intronic
960753565 3:120983133-120983155 CAGGCCAGAAAGAAGCAGGCAGG - Intronic
961236986 3:125375437-125375459 CTGGCTGGAAAGACACAGCGTGG + Intergenic
962407363 3:135111504-135111526 CAGGCTAGAAAGCTGCAGGGAGG + Intronic
963534186 3:146507561-146507583 CAGGCTAGACAGTGGCAGCCTGG + Intergenic
965042351 3:163526165-163526187 CTGGCTAGTAATATGCAGTTTGG + Intergenic
965443260 3:168743055-168743077 CTTGCTAGAAAAATGCATCTTGG + Intergenic
967135421 3:186508937-186508959 CTGGCTAGACAGCAGGAGCCAGG + Intergenic
969258021 4:6015777-6015799 CTGGCTCCAAAGATGAAGGCAGG - Intergenic
970324434 4:14908757-14908779 CTGGGTAAAATGATGCAACCAGG - Intergenic
971602962 4:28619305-28619327 TTGGCTTGAAAGCTGGAGCCAGG - Intergenic
971638729 4:29100636-29100658 TTGGTTAGAAAGATGGAGGCAGG - Intergenic
972799582 4:42460685-42460707 CTGTCAAAAAAGATACAGCCAGG - Intronic
973638015 4:52877694-52877716 CTGGGTGGAAGGATGCAGCCGGG - Intronic
973899920 4:55458384-55458406 CTGACTGGAAAGAGGCAGCCAGG - Intronic
974233456 4:59148143-59148165 TGGGGTAGAAAAATGCAGCCGGG - Intergenic
975037331 4:69700032-69700054 ATGGCCAGTTAGATGCAGCCAGG - Intergenic
976866101 4:89729163-89729185 CTTGTTAGAAAGATTCAGCTTGG + Intronic
979187679 4:117818828-117818850 ATGGCTAGAAAAAAGCAGGCAGG + Intergenic
979553544 4:122018630-122018652 CAGCCTAGAAAGATACATCCTGG - Intergenic
980046583 4:127996033-127996055 CTTGCTGGAAAGATACAGGCAGG + Intronic
980100911 4:128540359-128540381 CTGGCTTTAAAGATGCAGGAAGG - Intergenic
981822620 4:148903402-148903424 CTCACTAGAAAGATGCTGGCAGG - Intergenic
984269573 4:177534937-177534959 CTGTTTATAAAGATGCAGCTAGG - Intergenic
986317589 5:6600918-6600940 CTGGCTGGACAGGTGGAGCCTGG - Intronic
986318614 5:6609364-6609386 CTGGCTAGAAAGATGCAGCCCGG - Intronic
986997573 5:13624857-13624879 CTGGCTAGAAACATGTGTCCAGG - Intergenic
988626288 5:32878620-32878642 CTGGCTAGCAATATGCAGAAAGG + Intergenic
990370060 5:55108845-55108867 CTGGCTGGAAATATTCAGCCAGG - Intronic
991770233 5:70033953-70033975 CAGGCTAAAAAACTGCAGCCGGG - Intronic
991960909 5:72043187-72043209 CTGGCCAGAAAGCTGGAGTCAGG + Intergenic
993044519 5:82852417-82852439 CTGGCAGGGAAGATGCAGACAGG + Intergenic
996556626 5:124785285-124785307 CACGGGAGAAAGATGCAGCCTGG - Intergenic
1000465432 5:161569882-161569904 GTGGCTTGCAAGATGCATCCTGG + Intronic
1001281402 5:170388997-170389019 GTGGCCAGAAGGCTGCAGCCTGG - Intronic
1002868616 6:1146244-1146266 ATGCCTAGAAAGAAGCAGCCAGG + Intergenic
1007346739 6:41236681-41236703 ATGGCTAGGAAGAAGCAGCCAGG + Intronic
1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG + Intronic
1009379060 6:63006950-63006972 CTGCCTAGCAAGGAGCAGCCTGG - Intergenic
1013406995 6:109852312-109852334 CATGGGAGAAAGATGCAGCCTGG - Intergenic
1013737763 6:113248102-113248124 ATGGCTAACTAGATGCAGCCAGG + Intergenic
1018830901 6:167442807-167442829 CTGGCCTGAAAAATTCAGCCGGG + Intergenic
1019885364 7:3899728-3899750 CTGGGGAGAGAGATGCAGCATGG - Intronic
1020051563 7:5085416-5085438 CTCTCTAGAAAGCTGCACCCTGG + Intergenic
1021255122 7:18382990-18383012 CTGGGTAGAAAGATGCATTGTGG + Intronic
1021635460 7:22688122-22688144 TTGGCTGGAAAGATGCTTCCTGG - Intergenic
1024074654 7:45812321-45812343 CTGGGCCGAGAGATGCAGCCAGG + Intergenic
1025052313 7:55741560-55741582 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025052707 7:55743108-55743130 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025130291 7:56371344-56371366 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025130611 7:56372642-56372664 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1026892047 7:73988022-73988044 CTTGCAAGAAAGAGGCTGCCAGG + Intergenic
1026901707 7:74040934-74040956 CTGGCTAACAAGATTCAGCAGGG - Intronic
1029127369 7:98303876-98303898 ATGGCTAGAAGACTGCAGCCAGG + Intronic
1029408979 7:100397058-100397080 CTGGAAAGAAAGCTGCAGCATGG + Intronic
1030140248 7:106296883-106296905 CTGGCTACAAACATGCAGCCAGG - Intergenic
1030661367 7:112222948-112222970 CATGGTAGAAAGATGCAGGCTGG - Intronic
1031130194 7:117824649-117824671 ATGGCTAGAAATTTGGAGCCTGG + Intronic
1031417977 7:121516169-121516191 ATGGCTAGAAAGATATGGCCAGG - Intergenic
1034206582 7:149321339-149321361 CTGAGGAGAAAGATGGAGCCTGG - Intergenic
1034982632 7:155488635-155488657 CTGGGCTGAAGGATGCAGCCAGG - Intronic
1035022446 7:155807548-155807570 CTGACTAGGCAGATGCAGACGGG + Intronic
1035272398 7:157728128-157728150 CTGGGCAGACACATGCAGCCCGG + Intronic
1035694704 8:1586364-1586386 CTGGCTCTGAAGATGCAGGCAGG - Intronic
1036996011 8:13657339-13657361 CTGGCTAGAAGAATGCAGCTGGG - Intergenic
1037667854 8:20986154-20986176 CTGCCTAAAAAGATGATGCCAGG + Intergenic
1041427558 8:57739315-57739337 CTGGCCAATGAGATGCAGCCAGG - Intergenic
1044792026 8:95857624-95857646 CTGGATAGAAAGATTCAATCGGG + Intergenic
1046553384 8:115745330-115745352 ATGCTTAGAAAGATGCAGCATGG - Intronic
1048278296 8:133084305-133084327 ATGACTAGAAAGAAGCAGTCAGG + Intronic
1050367051 9:4882274-4882296 CTGGGCAGAAAGAAGCTGCCAGG - Intronic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1055131272 9:72778205-72778227 ATGGCTAACAAGATGCAGCCAGG + Intronic
1061423446 9:130484448-130484470 CTGCCAAGAAAGGTGCAGCGGGG - Intronic
1062104163 9:134743697-134743719 CTGGCAATAATGATGCTGCCCGG + Intronic
1188306908 X:28570251-28570273 CTGGCTTGAGGAATGCAGCCTGG - Intergenic
1194823852 X:98537628-98537650 CATGGGAGAAAGATGCAGCCTGG - Intergenic
1198272607 X:135068579-135068601 CTGGTTAGATAGATGTAACCAGG + Intergenic
1200779108 Y:7198359-7198381 GGGCCTAGAAAGATGGAGCCTGG - Intergenic