ID: 986321288

View in Genome Browser
Species Human (GRCh38)
Location 5:6633989-6634011
Sequence GGGGGACGCCCCGGGGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986321288_986321303 17 Left 986321288 5:6633989-6634011 CCAGATCCCCCGGGGCGTCCCCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 986321303 5:6634029-6634051 TCCCCGAGTCCCCCGGCCCCGGG 0: 1
1: 0
2: 3
3: 33
4: 411
986321288_986321299 10 Left 986321288 5:6633989-6634011 CCAGATCCCCCGGGGCGTCCCCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 986321299 5:6634022-6634044 GTGCCCTTCCCCGAGTCCCCCGG 0: 1
1: 0
2: 4
3: 18
4: 212
986321288_986321307 24 Left 986321288 5:6633989-6634011 CCAGATCCCCCGGGGCGTCCCCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 986321307 5:6634036-6634058 GTCCCCCGGCCCCGGGAGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 137
986321288_986321302 16 Left 986321288 5:6633989-6634011 CCAGATCCCCCGGGGCGTCCCCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 986321302 5:6634028-6634050 TTCCCCGAGTCCCCCGGCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986321288 Original CRISPR GGGGGACGCCCCGGGGGATC TGG (reversed) Intronic