ID: 986321288

View in Genome Browser
Species Human (GRCh38)
Location 5:6633989-6634011
Sequence GGGGGACGCCCCGGGGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986321288_986321299 10 Left 986321288 5:6633989-6634011 CCAGATCCCCCGGGGCGTCCCCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 986321299 5:6634022-6634044 GTGCCCTTCCCCGAGTCCCCCGG 0: 1
1: 0
2: 4
3: 18
4: 212
986321288_986321302 16 Left 986321288 5:6633989-6634011 CCAGATCCCCCGGGGCGTCCCCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 986321302 5:6634028-6634050 TTCCCCGAGTCCCCCGGCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 239
986321288_986321307 24 Left 986321288 5:6633989-6634011 CCAGATCCCCCGGGGCGTCCCCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 986321307 5:6634036-6634058 GTCCCCCGGCCCCGGGAGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 137
986321288_986321303 17 Left 986321288 5:6633989-6634011 CCAGATCCCCCGGGGCGTCCCCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 986321303 5:6634029-6634051 TCCCCGAGTCCCCCGGCCCCGGG 0: 1
1: 0
2: 3
3: 33
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986321288 Original CRISPR GGGGGACGCCCCGGGGGATC TGG (reversed) Intronic
900349663 1:2228482-2228504 GGGGGACGCGCGGGGGGCCCGGG + Intergenic
901109620 1:6784883-6784905 GGGGGACGCGCCGGGATCTCCGG - Intergenic
901934619 1:12618803-12618825 GGGGGAAGCCGCTGGGGAGCAGG + Intergenic
902804174 1:18850572-18850594 GGCGGAGGCCCCTGGGAATCAGG + Intronic
905110108 1:35588670-35588692 AGGGGAGGCCCCGGGGACTCTGG + Intronic
906460371 1:46031584-46031606 GGGTGAGGCCCCTGGGGAGCTGG + Exonic
906653817 1:47533585-47533607 GGGGGCGGCGCCGGAGGATCGGG + Intergenic
907284458 1:53370989-53371011 GGGGGACCCCCTGTGGGATACGG - Intergenic
915213328 1:154325565-154325587 GGCCGAGGCCCCGGGGGAGCGGG + Intronic
917962460 1:180155426-180155448 GGGGGACGAACCGGGCGAGCAGG - Intronic
917966678 1:180183230-180183252 GAGGGCTGCCCCGGGGGAGCTGG - Intronic
919570538 1:199242932-199242954 GGGGGAGGCCCTGGGGGACAAGG - Intergenic
922958714 1:229626345-229626367 GGGGGACTCACCTCGGGATCCGG - Exonic
924775629 1:247113044-247113066 GGGGGAAGCCCCGGGGGGAGGGG - Intergenic
1062911745 10:1216248-1216270 GGGGGAGGTCTCGGGGCATCAGG + Intronic
1064230747 10:13528345-13528367 GGCGGAGGCACCGGGGGACCGGG + Intronic
1073051648 10:100671077-100671099 GGGGGAGGCGGCGGGGGAGCGGG + Intergenic
1075069933 10:119313965-119313987 GTGGGGCGGCCCGGGGCATCTGG - Intronic
1075769027 10:124917461-124917483 CGGGGACGGCCCGGGGGCTGTGG + Intergenic
1076369854 10:129945186-129945208 GAGGGAGGCCTGGGGGGATCTGG + Intronic
1077085239 11:747002-747024 GGGGGACGCCCTGCGGGTGCAGG - Intergenic
1081993381 11:47349464-47349486 GGGGGTCGCCCAGGGTGGTCAGG - Intronic
1084555903 11:69875622-69875644 GGGTGACGCCAAGAGGGATCTGG - Intergenic
1087046921 11:93850380-93850402 GGGGGACGCCCCGGGTGCTGGGG - Intronic
1089042098 11:115461823-115461845 GGGGGACTCCCAGGGGTAGCAGG + Intronic
1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG + Intergenic
1089584579 11:119502327-119502349 GGGGGCTGCCCAGGGGGCTCAGG + Intergenic
1103856348 12:123973173-123973195 CGGGGAAGCCCCGGGGGAGCGGG - Exonic
1104704551 12:130933649-130933671 TGGGGACGCCCCGAGGGGCCTGG - Intergenic
1112752537 13:102597173-102597195 GGGGGTCGACCCGGGGGCTCCGG + Exonic
1113640561 13:111954016-111954038 GATGGACGCCCCGGGGGTGCTGG + Intergenic
1113662702 13:112118027-112118049 GGTGGAAGCCCTGGGGGATGGGG + Intergenic
1113911358 13:113842950-113842972 GGGGGAGGCCCCGGGGCAGGTGG - Intronic
1114670432 14:24408113-24408135 TGCTGACCCCCCGGGGGATCTGG + Exonic
1116835676 14:49767641-49767663 AGGAGAGGCCCCCGGGGATCGGG + Exonic
1118760815 14:68879367-68879389 GGGGGAAGCCCCTGGGGAAGCGG - Intronic
1122470924 14:101965189-101965211 GCGGGGCGCCCTGGGGGCTCCGG - Intronic
1122657663 14:103273294-103273316 GGGCGAGGCCGCGGGGGACCCGG - Intergenic
1122829114 14:104387123-104387145 GGGGAAGGCCCCTGGGGACCAGG + Intergenic
1123072035 14:105646698-105646720 GGGGGAAGCCCCTGGAGCTCAGG - Intergenic
1123411864 15:20067506-20067528 GGGGGACACCCCGGAGTAGCAGG - Intergenic
1123462258 15:20483811-20483833 GGGGCACATCACGGGGGATCAGG + Intergenic
1123521208 15:21074625-21074647 GGGGGACACCCCGGAGTAGCAGG - Intergenic
1123655801 15:22516560-22516582 GGGGCACATCACGGGGGATCAGG - Intergenic
1123937350 15:25200421-25200443 GGGGGACTTCCAGGGGGAGCAGG - Intergenic
1124272945 15:28299822-28299844 GGGGCACATCACGGGGGATCAGG + Intronic
1124309711 15:28611743-28611765 GGGGCACATCACGGGGGATCAGG - Intergenic
1124374790 15:29123200-29123222 GGGGGACACCCAGGATGATCTGG - Exonic
1124629342 15:31327897-31327919 GGGCGAGGCCCCGGGCGTTCCGG - Intronic
1125852726 15:42920402-42920424 GGGCGGCGCCCTGGGGGGTCGGG + Intronic
1128456543 15:67834642-67834664 GGGAGCCGCCCCGCGGGTTCTGG + Intergenic
1129242432 15:74259521-74259543 GGGGGAGGCCCCAGGGGAAGGGG - Intronic
1129659111 15:77543211-77543233 AGGGGACGCCCCCGGAGATGAGG - Intergenic
1130327066 15:82889661-82889683 GGGGCAAGCCGCGGGGGACCAGG + Intronic
1131369497 15:91867803-91867825 GGCGGAGGCCCCGGGTGTTCTGG + Intronic
1131829094 15:96343047-96343069 GGGGGCCGCTCCGGGGGAGATGG - Intergenic
1132163887 15:99566230-99566252 GAGGGTCGCCCGGGGGGCTCCGG + Intronic
1132641964 16:982069-982091 GGGGGGCGCCCGGGGCGACCCGG + Exonic
1133072247 16:3254395-3254417 GGGGGGCGCCCCGGGGCAGAAGG - Exonic
1133272031 16:4614977-4614999 GCCGGGCGCCCCGGGGGAGCGGG + Intronic
1133339882 16:5029228-5029250 GGGAAACGGCCCGGAGGATCTGG + Intronic
1136419512 16:30123134-30123156 GGGGGTCGGCCCGGGGGTCCCGG - Exonic
1137576988 16:49606552-49606574 TGGGGATGCCCAGGGGGCTCAGG + Intronic
1137718599 16:50613815-50613837 GGGGGAAGCCCCGGGAGAGAAGG - Intronic
1138572417 16:57884330-57884352 GGTGGAGACCCCGGGGGCTCGGG + Exonic
1139354165 16:66357397-66357419 GGGGGAGGCACAGAGGGATCCGG - Intergenic
1139918021 16:70439806-70439828 GGGAGATGCCCCGGTGGATGAGG - Intergenic
1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG + Intronic
1142382265 16:89739611-89739633 TGGGGACACCCCTGGGGGTCGGG + Intronic
1143554426 17:7651671-7651693 GGGCGACGCCTCGGGGGCGCAGG + Intronic
1147177231 17:38663539-38663561 GGGGGAGGCTCTGGGGGCTCTGG - Intergenic
1147869785 17:43579092-43579114 AGGGGACGCCCCAGGGGCACTGG - Intronic
1148183134 17:45620770-45620792 GAGGGGCGCCCCGCGGGATGCGG - Intergenic
1148265716 17:46224921-46224943 GAGGGGCGCCCCGCGGGATGCGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1150217016 17:63476700-63476722 GCGGGAGGCTCCGGGGGGTCGGG + Intergenic
1151313954 17:73310916-73310938 GGGGGACGCGCCGGGGGCAGGGG + Intronic
1151555224 17:74843192-74843214 GGGGGGCGGCCCGGGGGCTGCGG + Exonic
1151826666 17:76527699-76527721 CAGGGCAGCCCCGGGGGATCCGG - Exonic
1152435453 17:80273588-80273610 GGTGGAGGCCCCAGGGGGTCTGG - Intronic
1154202388 18:12308401-12308423 GGGGGTCGCGCCGGGAGACCCGG - Intronic
1154241397 18:12657394-12657416 GGGAGACCCCCGGGAGGATCCGG - Intronic
1158635259 18:59150574-59150596 TGGGGACGCCCCTGGGGTTGGGG + Intronic
1158729890 18:60011110-60011132 GGGTGACGCCCCGGCGGCGCGGG + Intergenic
1160173825 18:76577177-76577199 GGGGGACACCCCTGGGGAAGGGG + Intergenic
1160988543 19:1851341-1851363 GAGGGACGCCCGGGAGGGTCGGG + Intergenic
1161028248 19:2046478-2046500 GAGGCACGCCCAGGGGGCTCAGG + Intronic
1161374716 19:3933521-3933543 GGAGGCCGCCCCGGGGGAGGCGG - Exonic
1162322089 19:9976547-9976569 GGGGCACTCACCGGGGGACCTGG + Exonic
1162929881 19:13952561-13952583 GGCGGCGGCCCCGGGGGAGCCGG + Exonic
1163300947 19:16445785-16445807 AGGGGACGCACCAGGGGATGAGG + Intronic
1163578087 19:18122362-18122384 GGAGGACTCCCCAGGGGCTCAGG - Intronic
1163700508 19:18784456-18784478 GGTGGGCGGCCAGGGGGATCCGG + Intronic
1166137772 19:40787606-40787628 GGGAGAGGCCCAGGGGGGTCAGG + Intronic
1166205107 19:41264479-41264501 GGGGGCCACCCCGGGGGCCCGGG + Exonic
925912658 2:8583558-8583580 CGGGCACCCCCCGGGGAATCCGG + Intergenic
931245535 2:60489707-60489729 GGAGAACGGCCCGGGGGCTCAGG - Intronic
931762840 2:65432227-65432249 GGCGGAGGCTCCGGGGGCTCGGG + Intronic
933684611 2:85133419-85133441 CTGGGACGCCCCGGCGGAGCAGG + Exonic
934660189 2:96138996-96139018 GGGGGGCGCCCCAGGGTCTCAGG - Intergenic
941665623 2:168241556-168241578 GGGAGAGGCCCCTGGGGATCTGG - Intronic
942458174 2:176151922-176151944 GGCGGAGGCGCCGGGGGAGCTGG - Exonic
948819072 2:240529380-240529402 GGGAGAAGCCACTGGGGATCTGG + Exonic
949014387 2:241701551-241701573 GGCTGAGGCCCCGGGGGCTCGGG + Intergenic
1172522341 20:35576211-35576233 GTGGGATCCCCCGGGAGATCTGG + Intergenic
1172979034 20:38927100-38927122 GAGGAGCGGCCCGGGGGATCCGG - Intronic
1173579202 20:44135021-44135043 GGGGGATGCCTGGGGGGCTCAGG + Intronic
1173665813 20:44762283-44762305 GGGGGAGGCCCCTGGGGTTGGGG + Intronic
1175844836 20:62052819-62052841 GGGGGATGGCGCGAGGGATCTGG - Intronic
1176547284 21:8207443-8207465 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1176555189 21:8251652-8251674 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1176566235 21:8390490-8390512 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1176574109 21:8434676-8434698 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1179534362 21:42041887-42041909 GGGGGCAGCCCCGGGGGGTGTGG - Intergenic
1179577523 21:42317294-42317316 GGGGAAATCCCTGGGGGATCTGG + Intergenic
1179994443 21:44967483-44967505 GGGGGACCCCCAGTGGGACCCGG - Intronic
1183506237 22:38210465-38210487 GGGGGAGGCCGCGGTGAATCAGG + Intronic
1184004782 22:41699963-41699985 GGGTGAGGTCCCGGGGGATCCGG - Intronic
1184280784 22:43436330-43436352 GCGGGACGCCCCTGGGGAGGCGG - Intronic
1184789600 22:46691679-46691701 GGGAGAGGCCCCTGGGGCTCCGG + Exonic
1185249206 22:49790916-49790938 AGGGGACGCCCCGGAGCCTCTGG + Intronic
1203252157 22_KI270733v1_random:123728-123750 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1203260211 22_KI270733v1_random:168811-168833 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
950103915 3:10376535-10376557 AGAGGAAGCCCCAGGGGATCAGG - Intronic
951080384 3:18445016-18445038 GGGGGACGCCCCGGCCGCTCCGG - Intronic
968048110 3:195635346-195635368 GGGGGAGGCCGCGGGGCAACCGG - Intergenic
968048123 3:195635377-195635399 GGGGGAGGCCGCTGGGGACCCGG - Intergenic
968048195 3:195635531-195635553 GGGGGAGACCGCGGGGGACCCGG - Intergenic
968099209 3:195954089-195954111 GGGGGAGACCGCGGGGGACCCGG + Intergenic
968099279 3:195954243-195954265 GGGGGAGGCCGCTGGGGACCCGG + Intergenic
968099292 3:195954274-195954296 GGGGGAGGCCGCGGGGCAACCGG + Intergenic
968306416 3:197654390-197654412 GGGGGAGACCGCGGGGGACCCGG + Intergenic
968306488 3:197654544-197654566 GGGGGAGGCCGCTGGGGACCCGG + Intergenic
968306501 3:197654575-197654597 GGGGGAGGCCGCGGGGCAACCGG + Intergenic
970195652 4:13547827-13547849 GGGGGGCGCCCAGTGGGCTCGGG + Intergenic
977176896 4:93829220-93829242 GGTGGACGGCCGGGGGGAGCTGG + Exonic
981474995 4:145179755-145179777 CGGGGACGGCCCGGCGGGTCTGG - Intronic
985565051 5:611525-611547 AGGGGACACCCCTGGGGGTCTGG + Intergenic
985577686 5:681369-681391 GGGTGACCCCCTGGGGGCTCAGG - Intronic
985743479 5:1633695-1633717 GGGGGAGGCCGCGGGGCAACCGG + Intergenic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
986721472 5:10563962-10563984 GGGGGACGCCGGGGCGGAGCCGG - Intergenic
996398563 5:123036305-123036327 GGGGGAGACCCTGGGGGAGCTGG - Intronic
998341411 5:141421289-141421311 TGGGGACGCTGCGGGGGTTCCGG + Exonic
1001594730 5:172890869-172890891 GGGGGAGGACCTTGGGGATCCGG + Intronic
1002455754 5:179344823-179344845 CGGGGACGCTCCGGAGGAGCCGG - Intronic
1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG + Intronic
1003872250 6:10412527-10412549 GGGGGAGGCCGCGGGGGAGGGGG + Intronic
1006096930 6:31661920-31661942 GGGGGACTCCCAGGAGGGTCTGG + Exonic
1006187658 6:32190042-32190064 GGGTGAACCCCCGGGGGAGCCGG - Exonic
1014009711 6:116461904-116461926 GCGCGACGCCCCGGGGGACGAGG + Exonic
1019492501 7:1321883-1321905 GGGGGACAGACCGGGAGATCAGG + Intergenic
1022113049 7:27243171-27243193 GAGGGACGGCCCGAGGGCTCAGG - Exonic
1023990076 7:45123621-45123643 GGGGTCAGCCCCGGGAGATCTGG + Intergenic
1029279078 7:99425184-99425206 GGGGAACGGCCCCGGGGGTCAGG + Exonic
1032037367 7:128530879-128530901 GGGGGCCGCCGAGGCGGATCCGG + Intergenic
1035260634 7:157659375-157659397 GGGGGACGGCCGCGGGGATGGGG + Intronic
1035735026 8:1881557-1881579 AGGGGAGCCCCCGGGGGATGGGG + Intronic
1037841872 8:22250650-22250672 GGAGGAAGCCCTGGGGGACCTGG - Exonic
1041476818 8:58276756-58276778 GGGAGACTCCCCGAGGGTTCAGG - Intergenic
1048812637 8:138302690-138302712 GGGGGAGGCCCCAGGGACTCAGG - Intronic
1049509251 8:143019281-143019303 GGGGGGCGCCCCTGGGGCCCAGG - Intronic
1049665688 8:143841489-143841511 GGGGGAAGACCCGGGGCATCTGG + Intergenic
1054456533 9:65434258-65434280 GGGGGCAGGCCCCGGGGATCCGG - Intergenic
1057259860 9:93577247-93577269 GGGGGAGGCGGCGGGGGCTCCGG - Intronic
1058161339 9:101573380-101573402 GGGGGATGTCCTGGTGGATCCGG + Exonic
1061348006 9:130042623-130042645 GCGGCTCGCCCCGGGGGATTAGG + Intronic
1061903565 9:133685120-133685142 GAGGGGTGCGCCGGGGGATCTGG - Intronic
1203468560 Un_GL000220v1:106878-106900 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1203476381 Un_GL000220v1:150850-150872 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1196993643 X:121356675-121356697 GGCGGACGCCCTGCGGGATCTGG - Intergenic