ID: 986321512

View in Genome Browser
Species Human (GRCh38)
Location 5:6635596-6635618
Sequence CTAAAATGCTTGCATGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986321503_986321512 19 Left 986321503 5:6635554-6635576 CCCCCCTGTGGGATCACATGAAT 0: 1
1: 0
2: 0
3: 7
4: 114
Right 986321512 5:6635596-6635618 CTAAAATGCTTGCATGGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 131
986321505_986321512 17 Left 986321505 5:6635556-6635578 CCCCTGTGGGATCACATGAATTT 0: 1
1: 0
2: 2
3: 10
4: 165
Right 986321512 5:6635596-6635618 CTAAAATGCTTGCATGGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 131
986321507_986321512 15 Left 986321507 5:6635558-6635580 CCTGTGGGATCACATGAATTTAG 0: 1
1: 0
2: 3
3: 9
4: 129
Right 986321512 5:6635596-6635618 CTAAAATGCTTGCATGGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 131
986321504_986321512 18 Left 986321504 5:6635555-6635577 CCCCCTGTGGGATCACATGAATT 0: 1
1: 0
2: 1
3: 10
4: 124
Right 986321512 5:6635596-6635618 CTAAAATGCTTGCATGGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 131
986321506_986321512 16 Left 986321506 5:6635557-6635579 CCCTGTGGGATCACATGAATTTA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 986321512 5:6635596-6635618 CTAAAATGCTTGCATGGTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986321512 Original CRISPR CTAAAATGCTTGCATGGTGC TGG Intronic
903903072 1:26662980-26663002 CCAAAATGCTTCTATGGGGCCGG + Intergenic
905325218 1:37146920-37146942 ATAAAATGCTTGAATGTTGCTGG - Intergenic
905755241 1:40503747-40503769 CTGAAAGGCTTTCATGGTCCTGG + Intergenic
908515047 1:64883950-64883972 CTAAAAAGCAAGCATGGTGAGGG + Intronic
910675033 1:89807981-89808003 GTAAAATTCCTGCATGGTGCTGG + Intronic
910675526 1:89812592-89812614 CTCAACTGATTGGATGGTGCTGG + Intronic
912554476 1:110506281-110506303 CTAAAAAGCTTGAATGAGGCTGG - Intergenic
912683334 1:111742843-111742865 CTGAAGTCCTTTCATGGTGCTGG + Intronic
912770433 1:112459095-112459117 TTAAAATGTTTAAATGGTGCTGG + Exonic
914705947 1:150170011-150170033 CTAAAATGCCTGGAGGGTTCTGG + Intergenic
918624818 1:186645107-186645129 CTAAAATCCCTGCCTGGGGCGGG + Intergenic
920357011 1:205381214-205381236 CTAAATTGTTTTCATGGTGTTGG + Intergenic
921196006 1:212759012-212759034 TGAAAATGCTTGAATGGTGTTGG - Intronic
1065798344 10:29328037-29328059 CAGAAATGCTGGCATGGAGCAGG - Intergenic
1067209956 10:44251812-44251834 CCAAAATGCAGGCATGGTACAGG - Intergenic
1068461278 10:57332712-57332734 CTAAAATGCTTGTGTGTTGGGGG + Intergenic
1068743639 10:60503371-60503393 ATAAAGTGCTTGCATAGTTCTGG - Intronic
1069577384 10:69540679-69540701 CCAACATGCTTGCATGCTGGAGG + Intergenic
1069842834 10:71350612-71350634 CTCATATGCAGGCATGGTGCTGG + Intronic
1073406063 10:103299258-103299280 CTAAACTAAATGCATGGTGCTGG + Intergenic
1084121076 11:67069299-67069321 CTCAACTGCTTGCCTGGTGGAGG - Intronic
1088576225 11:111274218-111274240 CTAAAGGGCCTGCATGGGGCTGG - Intronic
1088872674 11:113904739-113904761 CCAAAACATTTGCATGGTGCTGG + Exonic
1089041791 11:115458548-115458570 ATAAAATGCTTGCATGGACTAGG - Intronic
1090987109 11:131777912-131777934 CAATTATGCTTGCATGGTGAGGG + Intronic
1091366431 11:135024802-135024824 TTAAAATGCATGAATGGGGCTGG - Intergenic
1091385663 12:93076-93098 CTAAAAGCCCTGCAAGGTGCAGG + Intronic
1091859834 12:3770918-3770940 CTGGAATGCTTGCATGTTCCTGG + Intergenic
1093093936 12:14951384-14951406 CTAAAACACTTGCATAGTTCTGG + Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1101994729 12:109516927-109516949 CTAAAGAGCTTCCATGTTGCAGG - Intronic
1102215618 12:111159444-111159466 CTAAAATCCTTGCAGGTGGCTGG - Intronic
1102421828 12:112809363-112809385 TTAAAATGCTTGTATAGTGAGGG - Intronic
1105965971 13:25385179-25385201 CTGAAATGCCTGCATGCTGGTGG + Intronic
1108755278 13:53493753-53493775 CTACAATGCTTTCACGGTGCGGG + Intergenic
1110305650 13:73984215-73984237 CAAAAATGATGGCATGCTGCAGG - Intronic
1112966935 13:105208870-105208892 CGAAAATGCTGGCATGTAGCAGG - Intergenic
1115095916 14:29635376-29635398 CCAAAGAGTTTGCATGGTGCCGG - Intronic
1119974653 14:79011982-79012004 ATAAAATTCTTGCATGGTAATGG - Intronic
1121840241 14:97127959-97127981 ATGAAATGCTGGGATGGTGCAGG + Intergenic
1125198598 15:37077583-37077605 ATGAAATGCTTCTATGGTGCTGG + Intronic
1125416713 15:39461334-39461356 CTCAGATGTTTGCATGGTGTCGG + Intergenic
1127623533 15:60757796-60757818 CCCAAATGCTTGCTTTGTGCAGG + Intronic
1127749760 15:62023845-62023867 CTAAAATGCTTCCACTGTGAAGG - Exonic
1130821522 15:87501313-87501335 CTAAAAGGCTGGCATGGAGCTGG - Intergenic
1137477196 16:48818992-48819014 CTCAAATGCTTGCAAGGTCCAGG + Intergenic
1137800119 16:51255343-51255365 CAAAAAGGAATGCATGGTGCAGG - Intergenic
1140787320 16:78355304-78355326 TAAAAATGCGTGTATGGTGCTGG + Intronic
1141424748 16:83937563-83937585 CTCAAATGATTGCATTGTGTAGG - Intronic
1142235309 16:88919600-88919622 CCAAACTGCACGCATGGTGCAGG + Intronic
1143285315 17:5784806-5784828 CAAATATGCTTGCATGTGGCAGG - Intronic
1145201693 17:20951297-20951319 ATAAAATACTTGCATCGAGCAGG + Intergenic
1149025298 17:52020244-52020266 CTAAGAAGCTTGCATTGTTCAGG - Intronic
1149031208 17:52084627-52084649 CTGAAAAGCTTGCATGGAACTGG - Intronic
1156819223 18:41352043-41352065 CTAAAAAGTCTCCATGGTGCAGG + Intergenic
1159946482 18:74447823-74447845 CTATAAAGCTTGCAGGCTGCAGG + Intronic
925485553 2:4325476-4325498 CTAATATACGAGCATGGTGCTGG + Intergenic
926513457 2:13811185-13811207 CTAAACTGTTTTCATGGTTCCGG + Intergenic
927178745 2:20428782-20428804 TTAAAATGCTTATATGGGGCTGG + Intergenic
928842866 2:35632006-35632028 CTGAAATTCTTGCATTGTGTAGG - Intergenic
931545439 2:63379910-63379932 ATAAAATTTTTGCATGATGCTGG - Intronic
932488440 2:72103070-72103092 CTAAAATGCATACATTGTACAGG - Intergenic
932587418 2:73040105-73040127 CTAAAGTGCTTGTAAGGGGCTGG - Intronic
942486731 2:176447614-176447636 CTTACATGCTTACAAGGTGCAGG - Intergenic
942488063 2:176459963-176459985 CTAAAATGTTTGCATTTTCCAGG - Intergenic
942962512 2:181849003-181849025 TTAAGATGCTTGCAGGGTGGAGG + Intergenic
944936499 2:204574709-204574731 CTGAACTGCTTATATGGTGCTGG + Intronic
945134091 2:206607358-206607380 CATAAATGCATGCATGGAGCTGG - Intronic
948705582 2:239790273-239790295 ATAAGATGCTGGCAGGGTGCTGG - Intronic
1171812621 20:29757440-29757462 TTAAAATTCTTCAATGGTGCAGG + Intergenic
1174013548 20:47470041-47470063 TTAAAATGCTTGTATGGGCCGGG + Intergenic
1175032577 20:55970411-55970433 TTAAAATGTGTGCATGGTGTGGG - Intergenic
1178413524 21:32385367-32385389 CTAAAATGCTTTCAAGGTCATGG + Intronic
1179081565 21:38175399-38175421 GTAAAATGCCTGATTGGTGCAGG + Intronic
1184372761 22:44093059-44093081 CCAAGATGCATCCATGGTGCCGG - Intronic
949309114 3:2675799-2675821 CTGAAATGCTTTCTTTGTGCTGG + Intronic
953186477 3:40642647-40642669 ATAAAATGCTTTCACAGTGCTGG + Intergenic
953208450 3:40852914-40852936 TTACAATGCTTCCATTGTGCAGG - Intergenic
955596895 3:60600910-60600932 CAAAAAAGCATGCTTGGTGCAGG - Intronic
956422606 3:69100422-69100444 CTCAAATGCCTCCATGGGGCAGG + Intronic
958994540 3:100888466-100888488 CTTAACTGCTTTCATGATGCAGG + Intronic
960169429 3:114441387-114441409 CTCAAGTGCTTTCATGCTGCAGG - Intronic
960467852 3:118019464-118019486 ATAAACTGCTTCTATGGTGCTGG - Intergenic
961065593 3:123872723-123872745 CTGAGATGCTGGCAAGGTGCTGG - Intronic
962460977 3:135612530-135612552 AAAAAATGCTTTCATGGTCCAGG + Intergenic
963598735 3:147359273-147359295 AAAAACTGCCTGCATGGTGCAGG + Intergenic
967990848 3:195129426-195129448 CAAAAATGGTTGCTTGGGGCTGG - Intronic
968734048 4:2286050-2286072 CTAGAGTGCCTGCATGGAGCAGG - Intronic
975124932 4:70771215-70771237 CTAATATACTTGCATGACGCAGG + Intronic
975427033 4:74241672-74241694 CTAAAATACTTATATAGTGCCGG - Intronic
975486887 4:74943722-74943744 CAAAAATGCTCGAATGGTGAAGG - Intronic
980641028 4:135579808-135579830 CTTAAATACTTGCATGTTGCAGG + Intergenic
983129142 4:163993271-163993293 CTAAAATGCTTGTATGTTTATGG + Intronic
984999051 4:185466774-185466796 CTAACATGCTTGTTTGCTGCTGG + Intronic
985391280 4:189492988-189493010 CTGAAATCCTTGCATGCTTCTGG - Intergenic
986321512 5:6635596-6635618 CTAAAATGCTTGCATGGTGCTGG + Intronic
986815037 5:11399852-11399874 CTAAAATGCATACATGGTTTTGG - Intronic
990567436 5:57043405-57043427 CCAGAATGCTTACATGGGGCTGG - Intergenic
995889819 5:116938435-116938457 CTGAAATGCATGAATGCTGCTGG + Intergenic
998502115 5:142642457-142642479 GTCAAGTGCTTGCATGATGCAGG - Intronic
999501434 5:152150480-152150502 CTCAAATGCTTACAGGGTCCAGG - Intergenic
999819816 5:155215477-155215499 GTAAAATGGTTCCATGGTGTTGG + Intergenic
1000656230 5:163881776-163881798 CTAAAACCCTTGCATTGTCCTGG + Intergenic
1002545009 5:179935863-179935885 CTAACATGCTTGCATTGTCCAGG - Intronic
1002696617 5:181096446-181096468 CTGCAATGCTTGCAAAGTGCAGG - Intergenic
1002698005 5:181102927-181102949 CTGCAATGCTTGCAAAGTGCAGG + Intergenic
1007267024 6:40604257-40604279 AGAACATGCTTGCTTGGTGCTGG + Intergenic
1007632707 6:43281736-43281758 CGAAAATGCTAGCAAAGTGCTGG + Intronic
1012931186 6:105318577-105318599 CTAGAATGCCTGCATGATGGGGG + Intronic
1019056562 6:169227783-169227805 TTAAAATGCATGCATTGGGCCGG + Intronic
1020183458 7:5940644-5940666 CAAAAATGCTTCCATGAGGCTGG + Intronic
1020299452 7:6784114-6784136 CAAAAATGCTTCCATGAGGCTGG - Intronic
1028160428 7:87478172-87478194 CTAAAATCATTGCATTGTCCTGG - Intronic
1028747130 7:94339848-94339870 ACAAAATGCTTGCATGGGGGTGG + Intergenic
1029630959 7:101749761-101749783 TTAAAATGCCTGCAAGGTGGGGG + Intergenic
1033129576 7:138734379-138734401 CTAAAATGTATGCATTGAGCTGG - Intronic
1035489425 7:159259916-159259938 CTCAAATTCTTGCATGGGGTTGG + Intergenic
1038281112 8:26165839-26165861 ATTAAATGCTTGCATGTTCCAGG - Intergenic
1042192671 8:66203403-66203425 ATAACATGCTTGCATTTTGCAGG + Intergenic
1042402774 8:68368999-68369021 CTAAAATCCTTGCATTATCCAGG - Intronic
1044417009 8:91949729-91949751 ATAAAAAGATTGCAGGGTGCAGG - Intergenic
1045202881 8:100003998-100004020 TTAAAATGCTTGTATTCTGCAGG + Exonic
1045483247 8:102609904-102609926 CTCAACAGCTTGCATGGTGTGGG - Intergenic
1048087653 8:131201543-131201565 GAAAAATGCTTTCATGGTCCAGG + Intergenic
1048190948 8:132288323-132288345 ATAAATTGCTTGTATGGTACAGG + Intronic
1048532956 8:135266931-135266953 CTAGAATTCTTGGGTGGTGCAGG - Intergenic
1055452863 9:76446390-76446412 CTAAGAAGATTGCATGGAGCGGG - Intronic
1056250933 9:84747322-84747344 CTAAAATGATTGCATACGGCAGG - Intronic
1057793662 9:98140737-98140759 CTAAAATGCATGCATAGGCCAGG - Intronic
1058015109 9:100022697-100022719 CTAAAGTCTTTGCATGGTCCAGG + Intronic
1058655092 9:107213080-107213102 TTAAATTGGTTGGATGGTGCTGG - Intergenic
1060317566 9:122526853-122526875 CCCTAATGCTTGCATTGTGCTGG - Exonic
1185616065 X:1422885-1422907 GGAACAAGCTTGCATGGTGCCGG + Intronic
1187896577 X:23986901-23986923 TAAAAGTGCTTGCATGCTGCAGG + Exonic
1194648322 X:96485271-96485293 CTAAAATGCTTTCTTTATGCTGG + Intergenic
1197456728 X:126685221-126685243 CAAAAATGTTTTCATAGTGCAGG - Intergenic
1198116305 X:133548449-133548471 CTAAAATGCATGCAATGTCCTGG + Intronic
1202180930 Y:22139282-22139304 ATAAAATCCTAGCATGGTGGAGG + Intergenic
1202210430 Y:22447118-22447140 ATAAAATCCTAGCATGGTGGAGG - Intergenic