ID: 986326974

View in Genome Browser
Species Human (GRCh38)
Location 5:6683297-6683319
Sequence CTCTGTGTCCAAAAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986326974_986326976 -10 Left 986326974 5:6683297-6683319 CCTTCTACCTTTTGGACACAGAG No data
Right 986326976 5:6683310-6683332 GGACACAGAGCAGATGTCACTGG No data
986326974_986326980 22 Left 986326974 5:6683297-6683319 CCTTCTACCTTTTGGACACAGAG No data
Right 986326980 5:6683342-6683364 CTTGGACTGTGGCTAGCTCCAGG No data
986326974_986326979 11 Left 986326974 5:6683297-6683319 CCTTCTACCTTTTGGACACAGAG No data
Right 986326979 5:6683331-6683353 GGAGCTTTTGGCTTGGACTGTGG No data
986326974_986326977 -1 Left 986326974 5:6683297-6683319 CCTTCTACCTTTTGGACACAGAG No data
Right 986326977 5:6683319-6683341 GCAGATGTCACTGGAGCTTTTGG No data
986326974_986326978 4 Left 986326974 5:6683297-6683319 CCTTCTACCTTTTGGACACAGAG No data
Right 986326978 5:6683324-6683346 TGTCACTGGAGCTTTTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986326974 Original CRISPR CTCTGTGTCCAAAAGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr