ID: 986328613

View in Genome Browser
Species Human (GRCh38)
Location 5:6701243-6701265
Sequence CACAAGAGAGGGCCTCCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986328609_986328613 -1 Left 986328609 5:6701221-6701243 CCATGTGTCAAAGGACCAGAGAC No data
Right 986328613 5:6701243-6701265 CACAAGAGAGGGCCTCCTCGAGG No data
986328607_986328613 14 Left 986328607 5:6701206-6701228 CCTGCAATGAACTGACCATGTGT No data
Right 986328613 5:6701243-6701265 CACAAGAGAGGGCCTCCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986328613 Original CRISPR CACAAGAGAGGGCCTCCTCG AGG Intergenic
No off target data available for this crispr