ID: 986330621

View in Genome Browser
Species Human (GRCh38)
Location 5:6713928-6713950
Sequence GGGCGGGGCCGCGTCGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986330603_986330621 12 Left 986330603 5:6713893-6713915 CCGTGCGCGCGCGGCCGGGCCTC No data
Right 986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG No data
986330614_986330621 -7 Left 986330614 5:6713912-6713934 CCTCGGGGCGCGGCGGGGGCGGG No data
Right 986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG No data
986330597_986330621 24 Left 986330597 5:6713881-6713903 CCGTCCGTCCGTCCGTGCGCGCG No data
Right 986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG No data
986330601_986330621 16 Left 986330601 5:6713889-6713911 CCGTCCGTGCGCGCGCGGCCGGG No data
Right 986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG No data
986330610_986330621 -2 Left 986330610 5:6713907-6713929 CCGGGCCTCGGGGCGCGGCGGGG No data
Right 986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG No data
986330596_986330621 25 Left 986330596 5:6713880-6713902 CCCGTCCGTCCGTCCGTGCGCGC No data
Right 986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG No data
986330599_986330621 20 Left 986330599 5:6713885-6713907 CCGTCCGTCCGTGCGCGCGCGGC No data
Right 986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG No data
986330595_986330621 30 Left 986330595 5:6713875-6713897 CCAGGCCCGTCCGTCCGTCCGTG No data
Right 986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986330621 Original CRISPR GGGCGGGGCCGCGTCGGGGC GGG Intergenic