ID: 986332095

View in Genome Browser
Species Human (GRCh38)
Location 5:6724911-6724933
Sequence ACAGCTGGTAGGTGTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986332083_986332095 25 Left 986332083 5:6724863-6724885 CCACCCTCCTGGGAGAGGCTGTT 0: 1
1: 0
2: 5
3: 36
4: 283
Right 986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG No data
986332084_986332095 22 Left 986332084 5:6724866-6724888 CCCTCCTGGGAGAGGCTGTTCTC 0: 1
1: 0
2: 2
3: 26
4: 281
Right 986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG No data
986332085_986332095 21 Left 986332085 5:6724867-6724889 CCTCCTGGGAGAGGCTGTTCTCG 0: 1
1: 0
2: 0
3: 21
4: 503
Right 986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG No data
986332082_986332095 29 Left 986332082 5:6724859-6724881 CCTGCCACCCTCCTGGGAGAGGC 0: 1
1: 0
2: 4
3: 55
4: 423
Right 986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG No data
986332087_986332095 18 Left 986332087 5:6724870-6724892 CCTGGGAGAGGCTGTTCTCGGCA 0: 1
1: 0
2: 3
3: 15
4: 183
Right 986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986332095 Original CRISPR ACAGCTGGTAGGTGTAAAGC AGG Intronic
No off target data available for this crispr