ID: 986333076

View in Genome Browser
Species Human (GRCh38)
Location 5:6732166-6732188
Sequence GAGATACAAAGCGCCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986333072_986333076 -6 Left 986333072 5:6732149-6732171 CCAGCTCTGCCCTGGGAGAGATA 0: 1
1: 0
2: 1
3: 27
4: 249
Right 986333076 5:6732166-6732188 GAGATACAAAGCGCCTGCCTGGG No data
986333068_986333076 19 Left 986333068 5:6732124-6732146 CCTTGGGGCTGAGATGGGGGAGG 0: 1
1: 2
2: 8
3: 95
4: 629
Right 986333076 5:6732166-6732188 GAGATACAAAGCGCCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986333076 Original CRISPR GAGATACAAAGCGCCTGCCT GGG Intronic
No off target data available for this crispr