ID: 986333594

View in Genome Browser
Species Human (GRCh38)
Location 5:6736230-6736252
Sequence CTCCAAATGACTCTTTTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986333588_986333594 11 Left 986333588 5:6736196-6736218 CCTTAAGCCCTCTGTGGACGGCT 0: 1
1: 0
2: 2
3: 9
4: 73
Right 986333594 5:6736230-6736252 CTCCAAATGACTCTTTTGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 135
986333591_986333594 3 Left 986333591 5:6736204-6736226 CCTCTGTGGACGGCTTGGAATGC 0: 1
1: 0
2: 0
3: 2
4: 93
Right 986333594 5:6736230-6736252 CTCCAAATGACTCTTTTGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 135
986333590_986333594 4 Left 986333590 5:6736203-6736225 CCCTCTGTGGACGGCTTGGAATG 0: 1
1: 0
2: 1
3: 6
4: 89
Right 986333594 5:6736230-6736252 CTCCAAATGACTCTTTTGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 135
986333586_986333594 16 Left 986333586 5:6736191-6736213 CCTAGCCTTAAGCCCTCTGTGGA 0: 1
1: 0
2: 1
3: 11
4: 144
Right 986333594 5:6736230-6736252 CTCCAAATGACTCTTTTGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986333594 Original CRISPR CTCCAAATGACTCTTTTGGC GGG Intronic
901363479 1:8725267-8725289 GTCAAAATAACTATTTTGGCCGG + Intronic
901430474 1:9211088-9211110 CTCCAAATGACTCTACTTGGAGG - Intergenic
903433724 1:23329925-23329947 ACCCAAAAGACTCTGTTGGCTGG - Intronic
904136048 1:28313409-28313431 CTCTAAAAGACAATTTTGGCTGG + Intergenic
905232591 1:36523676-36523698 CTCCATATGACTTTCTGGGCAGG + Intergenic
907443648 1:54493554-54493576 CTGCAAATAACTCAATTGGCTGG - Intergenic
909198180 1:72653161-72653183 CTCCAAATTATTATTTTGGGTGG + Intergenic
911897790 1:103459916-103459938 CTCCAGATTATTCTTTAGGCAGG + Intergenic
914827948 1:151149092-151149114 ATCAAAATGACTCTCTTGGCTGG + Intergenic
915901790 1:159852226-159852248 CTCAATATTATTCTTTTGGCAGG - Intronic
917067016 1:171107815-171107837 CTGGAAAGGACTCTTTTGGTAGG - Exonic
919393822 1:197020816-197020838 CTCCAAACAACTCTTCTGCCAGG - Intergenic
923867933 1:237960536-237960558 CTGCAAATGTGTCTTTTGGTTGG + Intergenic
1063998146 10:11640567-11640589 CTCCAGGTTACTCTTTTGACAGG - Intergenic
1064660951 10:17607580-17607602 ATCCAAATGACTCCTTTGATTGG - Intronic
1071305332 10:84294479-84294501 CTCCCAATGCCTCTTTTAGAAGG - Intergenic
1072490738 10:95903833-95903855 CTCCAAATCTCTCTTTAGCCTGG - Intronic
1075221632 10:120589866-120589888 CTCCAAATGACTTGTTGCGCTGG - Intergenic
1076069947 10:127481366-127481388 AACCAAATGTCTCTTTTGGAGGG - Intergenic
1078910913 11:15730963-15730985 CTCGAAATGTCCCTTTAGGCTGG - Intergenic
1079252684 11:18798565-18798587 CTCCAGATGATTCTGTTGACTGG + Intergenic
1080385581 11:31809142-31809164 TTGCTAATTACTCTTTTGGCTGG - Intronic
1081305175 11:41502942-41502964 CTCCTATTCACTCTTTTGACTGG + Intergenic
1084248902 11:67880616-67880638 CTCCAAATGGCCCTTTAAGCAGG - Intergenic
1087633577 11:100678421-100678443 CTCCAAATTCCTATTTTGGAGGG - Intergenic
1088194761 11:107262245-107262267 CTCCTGATGGCCCTTTTGGCTGG - Intergenic
1089705269 11:120273168-120273190 TTTCAAATGATTCTTTTCGCTGG - Intronic
1091270067 11:134302871-134302893 TTCCAATTGATTTTTTTGGCTGG + Intronic
1091759641 12:3078147-3078169 CCCCAAATGCCTGTTTTGTCTGG + Intronic
1092419186 12:8316038-8316060 CTCCAAATGGCCCTTTAAGCAGG - Intergenic
1092891004 12:12969165-12969187 CTTGAAACGACTTTTTTGGCTGG + Intergenic
1101819817 12:108175115-108175137 TGCCAAATGTCTCTTTGGGCAGG - Intronic
1102865478 12:116370745-116370767 CTTCAAATGAAGCTCTTGGCCGG - Intergenic
1105536179 13:21265878-21265900 CTTCAAGTGTCTGTTTTGGCTGG - Intergenic
1107277768 13:38696194-38696216 CTCCAAATACCTCTATTAGCAGG + Intronic
1107477370 13:40751973-40751995 CTTCAAGTGCCTCTTTTGGCTGG + Intronic
1108620503 13:52178766-52178788 ATCCAAGTATCTCTTTTGGCTGG + Intergenic
1108666248 13:52634283-52634305 ATCCAAGTGTCTCTTTTGGCTGG - Intergenic
1108937479 13:55901672-55901694 CTCATAATGACCATTTTGGCTGG - Intergenic
1109742253 13:66569312-66569334 TTTAAAATGACACTTTTGGCTGG - Intronic
1110856902 13:80306548-80306570 CTCCAAATGGCCCTTTTGTTAGG + Intergenic
1112158435 13:96843378-96843400 ATAAAAATGACTTTTTTGGCCGG + Intergenic
1116251901 14:42496485-42496507 CTGGAAATGATTCTTCTGGCTGG + Intergenic
1116550980 14:46237433-46237455 TTCCAAATGAGTGTTTTTGCAGG + Intergenic
1117018118 14:51539762-51539784 CTGCAAATGACTCAGATGGCTGG - Intronic
1117575160 14:57090784-57090806 CTCCAAATGGCTCTGTCAGCAGG + Intergenic
1124924444 15:34057436-34057458 ATCAAAATGACTATTCTGGCTGG - Intronic
1127210419 15:56768630-56768652 ATGAAAATGCCTCTTTTGGCTGG - Intronic
1132365743 15:101254956-101254978 CTCCAAATGAGTCTTTCTGCTGG + Intergenic
1137424455 16:48365897-48365919 CTCCAAATGGCTCTCCCGGCAGG - Exonic
1139116383 16:63959295-63959317 CTCCAAATGACTGAGTTGACTGG + Intergenic
1139202289 16:64990319-64990341 CTACACAAGACTCTTTTGCCTGG - Intronic
1139614479 16:68080697-68080719 ATCAAAATGCCTCCTTTGGCTGG + Intergenic
1142052265 16:87966539-87966561 CTCAAAATGCCTCTGTTGCCAGG - Intronic
1142928035 17:3258452-3258474 CTCCAAATGACTCTGTGGGATGG + Intergenic
1145409062 17:22640002-22640024 CTCCAAAGAAATCTTTTGTCAGG + Intergenic
1145946228 17:28776751-28776773 ATCAAAAGGAGTCTTTTGGCTGG - Intronic
1148630967 17:49108765-49108787 CTCTAAATGACTTTTTTCGTTGG - Intergenic
1149503780 17:57175738-57175760 CTCCAAATGAGATGTTTGGCAGG + Intergenic
1150644802 17:66971299-66971321 CTCCACAAGGCTCTTCTGGCTGG - Intronic
1152344833 17:79744957-79744979 TTTTAAAAGACTCTTTTGGCTGG - Intergenic
1155860412 18:30890941-30890963 CTTCAAAAGACTCATTTGGGAGG - Intergenic
1156245600 18:35294883-35294905 CTCCAAATAACTCATTTTTCAGG - Intergenic
1161712872 19:5859654-5859676 CTCAAAAGCACTCCTTTGGCCGG + Intergenic
1162058341 19:8079217-8079239 CTCTTAATGACTCTGTTGCCCGG - Intronic
1162864740 19:13537160-13537182 CTCCAAATGTTTCTGATGGCAGG - Intronic
1163281463 19:16320656-16320678 CTCCTAAGGACTCTTGTCGCTGG + Intergenic
1164415464 19:28043623-28043645 CTCCAAAGAACCCCTTTGGCAGG + Intergenic
1166249364 19:41556794-41556816 CTTCAAAAGATTTTTTTGGCAGG + Intronic
925867185 2:8238635-8238657 CTCCAGATGATTCTGTTGCCTGG + Intergenic
926911652 2:17857337-17857359 CTCCAAATGTCTCTTTCCCCAGG + Intergenic
927217979 2:20680365-20680387 TTCCAACTAACTCATTTGGCAGG + Intergenic
935091294 2:99897449-99897471 CTCAAAATGTCTCTTTGGCCAGG + Intronic
935606461 2:104976345-104976367 CTCCAAATGTCTCTATTGCATGG + Intergenic
936287776 2:111194443-111194465 CTCCACAAGACCCTTTTTGCAGG + Intergenic
937316034 2:120932654-120932676 CTCAAAATAACTCAGTTGGCTGG - Intronic
940696932 2:156991538-156991560 TTCCAACTGACTCAGTTGGCAGG - Intergenic
941460247 2:165762356-165762378 CTCTAAATGAGTCTTTTGAACGG - Intronic
942609406 2:177727295-177727317 CTGGATATGACTCTCTTGGCTGG - Intronic
944389984 2:199208002-199208024 CTGAAAATCACTCCTTTGGCAGG - Intergenic
1168747536 20:256755-256777 CTCCAAAGGACGCTATTGGGGGG + Intergenic
1168987679 20:2064310-2064332 TTCAAAACTACTCTTTTGGCTGG - Intergenic
1173522814 20:43711997-43712019 TTCCAAAGGAATCTTTTGGGTGG + Intronic
1173610798 20:44366322-44366344 CTCAAAATGTCCCTATTGGCCGG + Intronic
1174667148 20:52270181-52270203 CTTCAAATGACTTTTTTTGTGGG + Intergenic
1175408069 20:58747904-58747926 CTCCAAATAACTCAATTGGCAGG + Intergenic
1177760490 21:25397568-25397590 CTCCAATGGACTCTTTTCCCTGG - Intergenic
1178089079 21:29142628-29142650 CTCCACATTACTCCTTTGGTTGG + Intronic
1180757487 22:18172774-18172796 CTACAAAAGACTTTTTTGGCTGG + Intronic
1181074289 22:20364674-20364696 CTACAAAAGACTTTTTTGGCTGG - Intronic
1181694549 22:24586376-24586398 CTCCAGAAGACTCTGCTGGCAGG - Exonic
951733029 3:25831909-25831931 CTCCAAATGAAACTTTGGACAGG - Intergenic
951758298 3:26117481-26117503 CTCCAAATGGCTCTTGGGGAAGG + Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
957063171 3:75498784-75498806 CTCCAAATGACCCTTTAAGCAGG - Intergenic
957840502 3:85662601-85662623 CTGCAAATGATACTTTTGTCAGG + Intronic
961290230 3:125840793-125840815 CTCCAAATGGCCCTTTAAGCAGG + Intergenic
961896869 3:130175233-130175255 CTCCAAATGGCCCTTTAAGCAGG - Intergenic
961917286 3:130390515-130390537 AGACAAATGACTGTTTTGGCTGG - Intronic
964907260 3:161732643-161732665 CTTCAAGTACCTCTTTTGGCAGG + Intergenic
967168768 3:186807290-186807312 CTTCAAATGACTGTTTTGTTTGG + Intergenic
967487736 3:190053752-190053774 CTTCAAAAGACACTTTTGGCTGG - Intronic
969746556 4:9077273-9077295 CTCCAAATGGCCCTTTAAGCAGG + Intergenic
969805915 4:9608666-9608688 CTCCAAATGGCCCTTTAAGCAGG + Intergenic
978132256 4:105213031-105213053 CTCCAATGGAGTCTTTTGGTGGG - Intronic
979484108 4:121251143-121251165 CTGCCGATGACTCTTTTGGCTGG - Intergenic
981073683 4:140570103-140570125 CTTCCACTGACTCTTTTGGGGGG - Intergenic
985285348 4:188331339-188331361 CTGAAAATGACTTTTGTGGCTGG - Intergenic
986333594 5:6736230-6736252 CTCCAAATGACTCTTTTGGCGGG + Intronic
996305731 5:122045383-122045405 CTACCAATGACATTTTTGGCAGG - Intronic
997856119 5:137374198-137374220 CTCCAAAAGACCAATTTGGCTGG + Intronic
999041481 5:148418030-148418052 CTACAGATGATTCTTTTGTCAGG - Intronic
999401233 5:151265795-151265817 CTACAAAAGACTCTTGTGCCTGG - Intronic
1000714026 5:164618111-164618133 CTCCAAATGTGTCTTTTAACAGG - Intergenic
1001886914 5:175300860-175300882 CTCAAAATTACTCTTTTAGGTGG - Intergenic
1002660072 5:180785801-180785823 TTCCAAAGGAGGCTTTTGGCAGG + Intergenic
1007515205 6:42405407-42405429 CTCCCAATAACTCTTCTGGGTGG - Intronic
1008174381 6:48249371-48249393 CTACAAATGAATGTTTTGGATGG - Intergenic
1011475712 6:87749026-87749048 CTCAAAAAATCTCTTTTGGCTGG + Intergenic
1011490123 6:87883095-87883117 CTCCTAATGGCTGTTTTGGCAGG - Intergenic
1012697544 6:102407174-102407196 CTCAAAATCACTCTATTGGTGGG - Intergenic
1013569233 6:111404099-111404121 CTTCAAAGGACTCTCTTGGTAGG + Intronic
1017367416 6:153660463-153660485 ATCCAAATGGCACTTTTTGCAGG - Intergenic
1017674203 6:156796947-156796969 CTCCAAATGCCTCTTCTACCAGG - Intronic
1020327556 7:6986907-6986929 CTCCAAATGGCCCTTTAAGCAGG - Intergenic
1020350827 7:7216499-7216521 CTCCAGATGTTTTTTTTGGCTGG - Intronic
1022424824 7:30258385-30258407 CTTCAAAGGACTCTTTTGTTAGG + Intergenic
1024931952 7:54673369-54673391 CTCTAAATGACTCTGATGCCTGG - Intergenic
1027590970 7:80118746-80118768 CTCTAAATGCCTCTTTTTACTGG + Intergenic
1027712374 7:81621425-81621447 CTCAAAATGACTGTTTTGAAGGG + Intergenic
1029825252 7:103186244-103186266 TTTCAAATGACTTTTGTGGCTGG + Intergenic
1029946153 7:104535283-104535305 CTCCAAATGATACTTCTGTCAGG + Intronic
1034354255 7:150439315-150439337 CTCCACATCACTCTTTTTGAAGG - Intergenic
1036369059 8:8147188-8147210 CTCCAAATGTCCCTTTAAGCAGG + Intergenic
1036881831 8:12518454-12518476 CTCCAAATGTCCCTTTAAGCAGG - Intergenic
1038761389 8:30385992-30386014 TACCAAATGACTCTTTTTGCAGG + Intronic
1039460450 8:37739342-37739364 CTTCAAATTATTCTTTTGGTTGG + Intronic
1040129867 8:43782793-43782815 CACCATAGGTCTCTTTTGGCTGG - Intergenic
1041159445 8:55024016-55024038 CTAGAGATGACTCTTTTGACAGG - Intergenic
1042642503 8:70951736-70951758 CTCCAAGTCTCTCTCTTGGCAGG + Intergenic
1046230808 8:111354482-111354504 GTCTGAAAGACTCTTTTGGCTGG - Intergenic
1046519420 8:115305059-115305081 CTGGAAATGGCTCTTTTGGGAGG + Intergenic
1050938454 9:11427466-11427488 CACCAAACCACCCTTTTGGCTGG + Intergenic
1052427295 9:28322174-28322196 CTCCAACTGTCCCTTTTGCCTGG + Intronic
1060498763 9:124137129-124137151 CTGCAAATGACTCTTTTTAATGG + Intergenic
1061742705 9:132718752-132718774 CTCAGAATGAATCTCTTGGCTGG + Intergenic
1062611496 9:137376631-137376653 TTAAAAATGCCTCTTTTGGCCGG + Intronic
1188829043 X:34873724-34873746 CTGCAAAGGACTGATTTGGCAGG + Intergenic
1198670177 X:139071719-139071741 CTCAAAATGCCTTTATTGGCTGG + Intronic