ID: 986333663

View in Genome Browser
Species Human (GRCh38)
Location 5:6736729-6736751
Sequence GGCGGCGTGAGGCGTCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986333652_986333663 27 Left 986333652 5:6736679-6736701 CCTCAGCTCTTGGAGCCCATGGG 0: 1
1: 0
2: 3
3: 31
4: 301
Right 986333663 5:6736729-6736751 GGCGGCGTGAGGCGTCTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 59
986333657_986333663 11 Left 986333657 5:6736695-6736717 CCATGGGGTGACAGGAGATCAGC 0: 1
1: 0
2: 0
3: 14
4: 159
Right 986333663 5:6736729-6736751 GGCGGCGTGAGGCGTCTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 59
986333656_986333663 12 Left 986333656 5:6736694-6736716 CCCATGGGGTGACAGGAGATCAG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 986333663 5:6736729-6736751 GGCGGCGTGAGGCGTCTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986333663 Original CRISPR GGCGGCGTGAGGCGTCTTCC AGG Intronic
900234718 1:1582649-1582671 GGCAGGGTGAGGCCTCTTCAAGG - Intergenic
900577936 1:3393627-3393649 GGCGGGGTCAGGCGACTTCCCGG - Intronic
900865892 1:5268361-5268383 GGCGGGATGAGGGTTCTTCCCGG + Intergenic
900952493 1:5865752-5865774 GGCTGGGTGAGGCATCTTCATGG + Intronic
904335353 1:29793758-29793780 GGGTGCCTGAGGGGTCTTCCTGG - Intergenic
915978803 1:160407750-160407772 GGCAGCTTGAGGTGTCTTCAGGG - Intronic
916680066 1:167095486-167095508 AGAGGCATGAGGCATCTTCCTGG + Intronic
919818410 1:201456662-201456684 GGTGGGGGGAGGGGTCTTCCAGG + Intergenic
922478673 1:225924011-225924033 GGAGGCGGGAGGCGGCTTCGCGG - Intronic
922784512 1:228276328-228276350 GTAGGCGTGGGGCGGCTTCCCGG + Intronic
1062899032 10:1127812-1127834 GACGGCATGGGGCGTCTTCCGGG + Intronic
1070162571 10:73874684-73874706 GGCGGCGGGAGGCCCCTCCCCGG - Intergenic
1090462777 11:126906778-126906800 GGCTGCCTGTGGCTTCTTCCTGG + Intronic
1091473918 12:753426-753448 TGCTGAGTGAGGCGTCGTCCGGG + Exonic
1094375430 12:29783820-29783842 GGCGGCGCGCGGCGTCTGCCCGG + Intronic
1094564964 12:31590957-31590979 GGCGGCGAGAGGCGGCTGCGCGG - Exonic
1099927741 12:89038640-89038662 GGAGGCCTGTGGTGTCTTCCTGG - Intergenic
1101662060 12:106774671-106774693 GGGGGCGCGAGGCGTTTACCTGG + Exonic
1102197266 12:111034339-111034361 GGCGGCGGGCGGCGGCTGCCGGG + Intronic
1103341181 12:120221951-120221973 GGGGGCTAGAGGAGTCTTCCTGG - Intronic
1103377616 12:120469289-120469311 GGCGCCGTGAGGGGTCTGCGCGG + Intronic
1107603839 13:42040258-42040280 GGCGCTGGGAGGCGTCTCCCGGG + Intronic
1112438615 13:99409009-99409031 GCTGGCGTGAGTAGTCTTCCTGG - Intergenic
1119004174 14:70908460-70908482 GGCGGCGGGCGGCCTCTCCCGGG - Intronic
1120953378 14:90061792-90061814 GGGGGCGTGGCGCGTCTTCAGGG - Exonic
1124118496 15:26868173-26868195 GGCGGCGGGAGGCGCCGCCCGGG + Intronic
1124454463 15:29827525-29827547 GCCGGCTTGAGGCATCCTCCAGG + Intronic
1130957698 15:88639109-88639131 GGCAGCGGGAGGGGCCTTCCCGG + Intronic
1145840202 17:27988332-27988354 GGGGGTGTGATGCGTCCTCCTGG - Intergenic
1147206481 17:38841148-38841170 GGAGGTGTGTGGGGTCTTCCGGG + Intronic
1152634250 17:81423955-81423977 GGCCGCGAGAGGCTCCTTCCTGG - Intronic
1155054032 18:22169820-22169842 GGCGGGCTGAGGCGGCTCCCAGG + Intronic
1155152922 18:23136310-23136332 GGCGGCGAGAGGCGCCGGCCGGG - Exonic
1156275824 18:35581820-35581842 GGCGGCGGCAGGCGTCCTCCGGG - Intronic
1161072711 19:2270577-2270599 GGAAGCGGGACGCGTCTTCCCGG - Intronic
926057292 2:9781383-9781405 GGCTGCCTGAGTCATCTTCCGGG - Intergenic
933985123 2:87584413-87584435 GGCGGAGGGAGGCAGCTTCCAGG - Intergenic
936308718 2:111366398-111366420 GGCGGAGGGAGGCAGCTTCCAGG + Intergenic
942450117 2:176103989-176104011 GGCGGGCTGAGGAGGCTTCCGGG + Intergenic
1176362832 21:6012421-6012443 GGGGGCGGGGGGCGTGTTCCAGG + Intergenic
1176418859 21:6498792-6498814 CGCGGCTCGAGGCGGCTTCCGGG + Intergenic
1179694353 21:43107114-43107136 CGCGGCTCGAGGCGGCTTCCGGG + Intronic
1179760686 21:43526124-43526146 GGGGGCGGGGGGCGTGTTCCAGG - Intergenic
1179876040 21:44268034-44268056 GGGTGCGTGAAGCCTCTTCCCGG + Intergenic
1182811354 22:33119503-33119525 GGCGGCATGGGGTGGCTTCCTGG + Intergenic
954117991 3:48477891-48477913 GGTGGCCTCAGGCGGCTTCCTGG - Intronic
954160242 3:48716734-48716756 GGCGGGTGGAGGGGTCTTCCCGG - Intronic
966916078 3:184584681-184584703 GGGGGCGGGAGGCGCCTTCCAGG - Intronic
981093430 4:140756170-140756192 GGCGGCGGCAGGCGACTTCAGGG + Intergenic
985857694 5:2442950-2442972 GGCAGCGAGGAGCGTCTTCCCGG - Intergenic
986333663 5:6736729-6736751 GGCGGCGTGAGGCGTCTTCCAGG + Intronic
1002888021 6:1312803-1312825 GGCGGCGGGAGACGACTCCCTGG + Exonic
1003304723 6:4916002-4916024 GGCGGGGTGGGGAGGCTTCCAGG - Intronic
1004216987 6:13711959-13711981 TGCGCCGCGAGGCGTCCTCCCGG + Intergenic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1007236031 6:40392095-40392117 GGCGGCGGGAGGGGTCGTGCCGG - Exonic
1017245300 6:152217778-152217800 GGAGGAGTGAGGTGGCTTCCAGG + Intronic
1019613758 7:1949566-1949588 GGCGGGGAGGGGCCTCTTCCTGG + Intronic
1040551637 8:48442319-48442341 GGCGGTGTGGGGAGACTTCCTGG + Intergenic
1048146492 8:131849872-131849894 GGCAGCATGAGGCTTATTCCAGG - Intergenic
1050944203 9:11497857-11497879 GGTGGCGTGGGGTGGCTTCCAGG + Intergenic
1061853254 9:133428484-133428506 GGCGGCGTCAGGGGTCGACCCGG + Intronic
1190319468 X:49171793-49171815 GGCGGGGCGAGGGGGCTTCCGGG + Intergenic
1197781533 X:130165317-130165339 GTCGGCTTGAGGCCTTTTCCCGG - Intronic