ID: 986333686

View in Genome Browser
Species Human (GRCh38)
Location 5:6736915-6736937
Sequence CAGTCTCAGCAGAGAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 304}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986333686_986333690 3 Left 986333686 5:6736915-6736937 CCTGTTTCTCTCTGCTGAGACTG 0: 1
1: 0
2: 2
3: 29
4: 304
Right 986333690 5:6736941-6736963 CGGATGAAACCAGGATTTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 157
986333686_986333695 24 Left 986333686 5:6736915-6736937 CCTGTTTCTCTCTGCTGAGACTG 0: 1
1: 0
2: 2
3: 29
4: 304
Right 986333695 5:6736962-6736984 GGATGGTCACCAGGTAGCTTGGG 0: 1
1: 1
2: 1
3: 4
4: 97
986333686_986333694 23 Left 986333686 5:6736915-6736937 CCTGTTTCTCTCTGCTGAGACTG 0: 1
1: 0
2: 2
3: 29
4: 304
Right 986333694 5:6736961-6736983 TGGATGGTCACCAGGTAGCTTGG No data
986333686_986333689 -6 Left 986333686 5:6736915-6736937 CCTGTTTCTCTCTGCTGAGACTG 0: 1
1: 0
2: 2
3: 29
4: 304
Right 986333689 5:6736932-6736954 AGACTGTGGCGGATGAAACCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
986333686_986333693 15 Left 986333686 5:6736915-6736937 CCTGTTTCTCTCTGCTGAGACTG 0: 1
1: 0
2: 2
3: 29
4: 304
Right 986333693 5:6736953-6736975 GGATTTAGTGGATGGTCACCAGG 0: 1
1: 0
2: 0
3: 5
4: 79
986333686_986333691 7 Left 986333686 5:6736915-6736937 CCTGTTTCTCTCTGCTGAGACTG 0: 1
1: 0
2: 2
3: 29
4: 304
Right 986333691 5:6736945-6736967 TGAAACCAGGATTTAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986333686 Original CRISPR CAGTCTCAGCAGAGAGAAAC AGG (reversed) Intronic
900580457 1:3406054-3406076 CAGTCTCAGCAGACACCCACTGG + Intronic
902607760 1:17578355-17578377 CACGCTTAGCAGAGAGTAACTGG + Intronic
903153008 1:21426387-21426409 CAGGCTCAGCAGAGAGCTGCTGG - Intergenic
903160122 1:21481594-21481616 CAGGCTCAGCAGAGAGCTGCCGG + Exonic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904199447 1:28810512-28810534 TAGTGCCAGCAGAGAGAAATTGG - Intergenic
904259274 1:29279176-29279198 CTGTAGCAGCAGAGAGAAAGAGG - Intronic
905673697 1:39810268-39810290 CAGTCTCAGCAGACAGAACAAGG + Intergenic
907020562 1:51062578-51062600 TAGTCTCGGAAGAGAGAAAAAGG - Intergenic
907792038 1:57676350-57676372 GAGTCTCAGTAGAGAAATACTGG + Intronic
909469355 1:76009519-76009541 CAGTCTTAGAAGAGAGGTACAGG - Intergenic
910191387 1:84599490-84599512 CAGTCACAGCAGGGAGAAAGTGG + Intergenic
912539899 1:110406872-110406894 TTCTCTCATCAGAGAGAAACTGG - Intronic
913241574 1:116834754-116834776 CTGTCTAAGCTGAAAGAAACAGG - Intergenic
913642273 1:120823971-120823993 CAGGCTCAGCAGAGAGCTGCTGG + Exonic
916482774 1:165230237-165230259 CAGCCTGAGCAGACAAAAACAGG + Intronic
917928075 1:179805624-179805646 CAGCTTGAGCAGAGAGAAACTGG - Intronic
918110818 1:181453921-181453943 CAGGCTCTGCAGACAGAGACTGG + Intronic
919145488 1:193629345-193629367 CAGTGTGAGAAAAGAGAAACAGG + Intergenic
921429207 1:215044209-215044231 TAGTCTGAGCAGGGAGAAAAAGG + Intronic
922905396 1:229170092-229170114 CATTCTGAGCAGAGTCAAACAGG - Intergenic
922974981 1:229777067-229777089 CAGTCTCACCAGAGAGTAAGGGG + Intergenic
923688227 1:236169082-236169104 GAGCCTCAGCAGAAGGAAACAGG + Intronic
923978727 1:239295900-239295922 CAGTCTCTTCTGAAAGAAACTGG - Intergenic
1063434953 10:6022076-6022098 CAGTCTCAGCTGAGACACAAGGG + Intronic
1063594925 10:7425804-7425826 CATTGTAAGTAGAGAGAAACAGG + Intergenic
1064789369 10:18938576-18938598 AGGTCACAGCATAGAGAAACAGG - Intergenic
1065143361 10:22741762-22741784 AAGACTAAGAAGAGAGAAACTGG + Intergenic
1067657417 10:48206764-48206786 CGGTTTCAGTGGAGAGAAACCGG - Exonic
1068287772 10:54962269-54962291 CAGTGCCAGCAGAGAGCAGCAGG - Intronic
1068621015 10:59182713-59182735 CAGTCTGAGCAGAAAAAAATAGG + Intronic
1069417151 10:68210613-68210635 CAGTCTCAGCTGAGGGAGAAAGG + Exonic
1070169266 10:73920436-73920458 CAGTCTCTGGAGTGAGAATCTGG - Intronic
1070468620 10:76752996-76753018 CAGTGTCAGGAGTGAGAAAGGGG + Intergenic
1070798416 10:79230602-79230624 GGGTCTCAGAAGAGAGAAAATGG + Intronic
1070934656 10:80283865-80283887 CTCTATCAGCAGAGAGCAACAGG + Intronic
1071515302 10:86293031-86293053 CAGGCTCAGGAGTGAGAGACTGG - Intronic
1072226537 10:93375252-93375274 CAGTGGCAGCTGAGAGAAACTGG + Intronic
1073024844 10:100480350-100480372 CTTCCTCAGCAGAGAGATACTGG + Intronic
1074097728 10:110328783-110328805 CAACCTCAGCAGAGAAAAACTGG - Intergenic
1075455277 10:122580973-122580995 CAGTATCCACACAGAGAAACAGG - Intronic
1075457398 10:122593676-122593698 CAGTATCCACACAGAGAAACAGG - Intronic
1075458473 10:122600171-122600193 CAGTATCCACACAGAGAAACAGG - Intronic
1075458977 10:122603207-122603229 CAGTATCCACACAGAGAAACAGG - Intronic
1075459609 10:122607266-122607288 CAGTATCCACACAGAGAAACAGG - Intronic
1075460241 10:122611325-122611347 CAGTATCCACACAGAGAAACAGG - Intronic
1075460873 10:122615384-122615406 CAGTATCCACACAGAGAAACAGG - Intronic
1075960151 10:126561709-126561731 CATTCCAAGCAGAGAGAATCAGG + Intronic
1076044755 10:127282857-127282879 CAGTCTCTGCAGAGTGATAGTGG + Intronic
1077344146 11:2038707-2038729 AGGGCACAGCAGAGAGAAACTGG + Intergenic
1078635996 11:13050834-13050856 CAGTCTCGCCTGAGAGAAAGAGG - Intergenic
1079106739 11:17576851-17576873 CAGTGGCTGCAGAGAGAGACGGG - Exonic
1081142671 11:39521851-39521873 CATTCTCAGCAGAGTAACACAGG + Intergenic
1081966973 11:47176194-47176216 CAGTCTCACTAGAGACATACTGG + Intronic
1082799471 11:57403940-57403962 CAGCCTCAGTAGAGAGGAACTGG - Intronic
1082828811 11:57600203-57600225 AAGTCAGAGCAGAGAGTAACAGG - Exonic
1084365642 11:68695983-68696005 CAGTGTCAGCAGAGACCACCTGG + Intergenic
1084390569 11:68873684-68873706 CAGTCTCCAAAGAGAGAATCTGG - Intergenic
1085353035 11:75812871-75812893 CAGACCCAGCAGTGAGTAACTGG + Intergenic
1086480900 11:87237427-87237449 CAGTCTTAGCAGACAGGACCAGG + Intronic
1087242447 11:95794617-95794639 CAGTCTTAACAGACAAAAACAGG - Intronic
1087956858 11:104299239-104299261 CAGTCTCAGCAAAGGAACACAGG - Intergenic
1088425492 11:109696994-109697016 CAGTCTCTGCAGAGAAAAGGTGG - Intergenic
1088562368 11:111128169-111128191 CAAAGTCTGCAGAGAGAAACAGG - Intergenic
1088583681 11:111338792-111338814 CAGTTTCAGCAGAGATAAAAAGG + Intergenic
1089899356 11:121964720-121964742 CAGCATCAGAAGAGAGCAACTGG - Intergenic
1090499419 11:127247186-127247208 AGACCTCAGCAGAGAGAAACTGG + Intergenic
1090557425 11:127891579-127891601 CAAGCATAGCAGAGAGAAACAGG - Intergenic
1090566535 11:127998613-127998635 CCCTCTCAGCAGAGAGAACAAGG + Intergenic
1090701491 11:129299868-129299890 CATTCTAAGCAGAAAGAAAAAGG + Intergenic
1091057717 11:132434454-132434476 CAGCGTCAGCAAAGAGAAACAGG - Intronic
1202827132 11_KI270721v1_random:93896-93918 AGGGCACAGCAGAGAGAAACTGG + Intergenic
1092666162 12:10801395-10801417 GAGTTACAGAAGAGAGAAACAGG + Intergenic
1093396701 12:18691957-18691979 CATTCTCAGCTGAGATAAAGTGG + Intronic
1094553929 12:31479381-31479403 CAGTGACTGCAGAGAGAAATAGG - Intronic
1099288847 12:80749822-80749844 CTGTCTTAGGAGAAAGAAACAGG - Intergenic
1099386240 12:82017173-82017195 CTTTCTCAGCAGTGAGAAAATGG + Intergenic
1101583850 12:106067358-106067380 AAGACCCAGCAGAGAGAATCAGG - Exonic
1101793896 12:107955376-107955398 CAGTCTCAGGAGGGAGGAAAGGG + Intergenic
1104015733 12:124960485-124960507 CAGCCTGGGCAGACAGAAACCGG + Intronic
1104125135 12:125838900-125838922 CTGGTTCAGCAGAGAGAAAAGGG - Intergenic
1104176128 12:126334491-126334513 CAGTTACACCAGAGAGAAAATGG - Intergenic
1105605796 13:21925697-21925719 CAGTGGCAGCAGGTAGAAACAGG - Intergenic
1106843119 13:33707951-33707973 AGGTCTCGGCAGAGAGAAAATGG + Intergenic
1109142256 13:58728911-58728933 CAGTCCTAGCATAGAGAAAGAGG - Intergenic
1109251359 13:60024468-60024490 AAGTCTCAGCAAAGAAATACAGG - Intronic
1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG + Intergenic
1110493508 13:76137056-76137078 CAGTGGCAGCAGTGAGAAATAGG + Intergenic
1111542120 13:89682617-89682639 CATTCTCAGCAGACAAACACAGG + Intergenic
1111740304 13:92196866-92196888 CACTCTCTGAAGATAGAAACGGG - Intronic
1111801890 13:92991363-92991385 CAGTCTCTGTAGAAAGCAACTGG + Intergenic
1112959133 13:105100975-105100997 CAGTTTCATTAGAAAGAAACTGG - Intergenic
1113304856 13:109066388-109066410 CAGTTTCAGCAGAAAGAAAATGG - Intronic
1113386083 13:109849662-109849684 CAGTCTCATAAGAGACAAACAGG - Intergenic
1114397608 14:22380975-22380997 CAGGATCATCAGAGAGAATCTGG + Intergenic
1114533107 14:23407542-23407564 CAGTCTCTGCAGAGAAAATGGGG + Intronic
1117516403 14:56506407-56506429 CACTCTCAGCTTAAAGAAACAGG - Intronic
1118168673 14:63363018-63363040 CAGCCTCAGCAGATTGAGACAGG - Intergenic
1118438440 14:65791844-65791866 AGGCATCAGCAGAGAGAAACAGG - Intergenic
1118668575 14:68098418-68098440 CTTTATCAGCAGAGTGAAACTGG - Intronic
1118742840 14:68753055-68753077 CAGTCTCTTCAAAGAGAAAATGG + Intergenic
1118883960 14:69851411-69851433 CAGTCTTGGCAGAGAGGAATGGG - Intergenic
1120284495 14:82481286-82481308 TAGGCTCAGCAGAGAGAATCTGG - Intergenic
1120487194 14:85129004-85129026 CAGACTCAGTAGGGAGAAACTGG - Intergenic
1120678839 14:87454501-87454523 CAATGTCAGAAGAGAGAAAGGGG + Intergenic
1121066002 14:90965620-90965642 CAGTCTCAGCAGAGCTTCACAGG - Intronic
1121223931 14:92307654-92307676 CAGTCTAAGAAGAGAGACTCTGG - Intergenic
1121323350 14:93005654-93005676 CTGCTTCTGCAGAGAGAAACCGG + Intronic
1122892050 14:104736569-104736591 CAGGCTCAGCTGAGGGAGACGGG - Intronic
1202859775 14_GL000225v1_random:73635-73657 CATCTTCAGCAGGGAGAAACGGG + Intergenic
1202863563 14_GL000225v1_random:100586-100608 CGTTTTCAGCAGAGAGAAACTGG + Intergenic
1124551943 15:30689192-30689214 CAGCCTCCACAGAGAGCAACAGG - Intronic
1124679303 15:31716479-31716501 CAGCCTCCACAGAGAGCAACAGG + Intronic
1125102311 15:35928629-35928651 CAGTCTCTGCAGTGAGAAGCAGG + Intergenic
1125402938 15:39323524-39323546 CATTCTCAGGAGAAAGAAAGGGG + Intergenic
1127775151 15:62258723-62258745 AAAACTCAGGAGAGAGAAACAGG - Intergenic
1128608975 15:69058765-69058787 CAGACTCAACAGAGGGAAAGAGG - Intronic
1130160427 15:81393641-81393663 CACTCACAGCAGAAAGAAATAGG + Intergenic
1130361950 15:83197432-83197454 CAATCTGAGTAGAGAGAACCTGG - Intronic
1130647884 15:85744679-85744701 CTGCCTCAGCAGAGAGGAAGAGG - Exonic
1131023061 15:89116099-89116121 CAGTCTGAGCATGGATAAACTGG - Intronic
1131885600 15:96908466-96908488 AAGGCTCAGCGGAGAGGAACTGG - Intergenic
1133238770 16:4402722-4402744 CTGGCTCAGCGGAGAGGAACTGG + Intronic
1133405424 16:5520536-5520558 CAGTCTCAGCAGAAGGATATAGG - Intergenic
1133755333 16:8758406-8758428 TGGTCTCAGCAGAGAGAAGAGGG + Intronic
1134289829 16:12895136-12895158 GAGTCTGAGCAGAGAGACAGGGG + Intergenic
1135425687 16:22333626-22333648 CAGTCCTATGAGAGAGAAACAGG - Exonic
1135603036 16:23799581-23799603 CAATTTTAGTAGAGAGAAACTGG - Intergenic
1136226923 16:28865894-28865916 CAGACTCCGCAGAGAGCAATGGG - Intronic
1139961675 16:70721579-70721601 CAGCCTCATTAGAGAGAAGCCGG - Intronic
1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG + Intronic
1140959614 16:79899516-79899538 GAGTCTGAGCAGAGAGGATCAGG - Intergenic
1142753592 17:2002696-2002718 CAATCTCAACAGAGAGAGACGGG - Intronic
1143173398 17:4943140-4943162 CAGTCTCAGCAGGGCGAGAAAGG - Intronic
1143917800 17:10306776-10306798 CAGTCTCAGCAGTGGCAAAGTGG - Intronic
1146763714 17:35500147-35500169 CAGACTCAGAAAACAGAAACAGG - Intronic
1147160981 17:38569314-38569336 CAGCCTCAGCAGGGAGACAGAGG + Intronic
1147241043 17:39090703-39090725 CAGTCGGGGCAGAGAGAAAAGGG - Intronic
1148797190 17:50202661-50202683 CAGTCAAACCAGAGAGAACCTGG + Intergenic
1148991462 17:51670165-51670187 CAGTCTCAGCAGCATGAAAATGG + Intronic
1150482244 17:65519556-65519578 CAGCCTCAGCTGGGAGAAGCAGG - Intergenic
1152297212 17:79475017-79475039 TTGTCACAGGAGAGAGAAACTGG - Intronic
1152480677 17:80550165-80550187 CAGTCTCAGGGGAGTGGAACAGG - Intronic
1153293202 18:3521408-3521430 AGGAGTCAGCAGAGAGAAACTGG - Intronic
1155457922 18:26040842-26040864 CAGTCTTAGTAGAGACAAACTGG + Intronic
1156419005 18:36930277-36930299 CATTCTAAGGAGAGAGAGACAGG - Intronic
1160483597 18:79265934-79265956 CATTTGCAGAAGAGAGAAACCGG - Intronic
1160843831 19:1158031-1158053 CGGACTCAGGAGAGAGAGACGGG - Intronic
1164381831 19:27742500-27742522 CAGTCTAATGATAGAGAAACTGG - Intergenic
1165546675 19:36543264-36543286 TAGTCTCAGAAATGAGAAACAGG - Intronic
1167388172 19:49176936-49176958 CACTTTCCACAGAGAGAAACTGG - Intronic
1167527347 19:49993220-49993242 CAAACTCAGCAGAGGGAAAAGGG + Intronic
1167610510 19:50505839-50505861 GAGGCCCAGCAGTGAGAAACTGG + Intergenic
1167839101 19:52099326-52099348 CAGTCTAGGAAGAGAGAGACAGG - Intergenic
1167854684 19:52228042-52228064 CACTCTCAAGAGAGAAAAACTGG - Exonic
1168104225 19:54156791-54156813 CAGTCGCAGCAGAAAGGAAAAGG - Exonic
1168268195 19:55234662-55234684 CACTCACAGCAGCGAGCAACAGG + Intronic
926503623 2:13684045-13684067 CAGTCTGCACAGAGAGAAAGAGG - Intergenic
926886660 2:17604519-17604541 CACTTTCCGCAGAGAGAAGCTGG + Intronic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
928135186 2:28682599-28682621 CAGACTCAGGAGAGATAGACAGG - Intergenic
929090400 2:38210887-38210909 CAGTGTCAGCAGAGACAACATGG + Intergenic
929821114 2:45274487-45274509 CAGCCTCAGCAGAGAGCCTCCGG - Intergenic
932631018 2:73343407-73343429 CCATCTCAGTAGAGAGATACAGG + Intergenic
933651796 2:84855752-84855774 AAGTCTCAGGAAAGAGAAAAAGG - Intronic
933885040 2:86711464-86711486 CAGTTTCAGCAGAGCCAACCAGG - Intronic
933925134 2:87085220-87085242 CAGTTTCAGCAGAGCCAACCAGG + Intergenic
934219080 2:90065007-90065029 CAGTGTCAGCACAGACAAAGTGG + Intergenic
935842821 2:107131920-107131942 CAGCCTCAGCAGAGTGATAGTGG - Intergenic
936241706 2:110793458-110793480 CCATGTCTGCAGAGAGAAACTGG + Intronic
936455940 2:112674408-112674430 CCGTCTCAGCAGAGCGAAACAGG + Intergenic
937017572 2:118619683-118619705 GAGGCTCAGAAGAGAGAGACAGG - Intergenic
937037402 2:118793440-118793462 CAGTCCCAGCAGGTAGAAATTGG + Intergenic
938391980 2:130914112-130914134 CTGTCCCAGCAGAGTGAAAGTGG + Intronic
938621704 2:133061732-133061754 CAATTTCAGAAGAGAGAGACAGG + Intronic
938844549 2:135195358-135195380 CAGGCTGATCAGAGAGAAAGGGG - Intronic
938949526 2:136244013-136244035 CTGTCCCTGCAGAGAGAAAGGGG + Intergenic
940913531 2:159229782-159229804 CAGTCTCCTCAGAGTGAAAGTGG - Exonic
945950325 2:216033508-216033530 CAAAATAAGCAGAGAGAAACAGG + Intronic
947585178 2:231351304-231351326 GAATCCCAGCAGAGAGAACCTGG + Intronic
947585439 2:231353533-231353555 GAATCCCAGCAGAGAGAACCTGG + Intronic
948090822 2:235293342-235293364 GATTCGCAGCAGAGAGAAATGGG + Intergenic
948124186 2:235552824-235552846 CCGGCTCAGCAGAGAGAGATGGG - Intronic
1169498321 20:6135342-6135364 CTGTCACAGGAGAGAGAAATGGG + Intergenic
1170488075 20:16840495-16840517 CAGTCCTAGAAGAGAGAAGCTGG + Intergenic
1170569527 20:17625065-17625087 CAGCCTCTGCAGGGAGCAACAGG + Intronic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172237390 20:33387483-33387505 GATTCTCAACAGAGAGAAAATGG - Exonic
1172957447 20:38771173-38771195 CACTCTGAGTAGAGGGAAACAGG - Intronic
1173124320 20:40322582-40322604 CAGGCTGAGATGAGAGAAACTGG + Intergenic
1174085784 20:48006319-48006341 GGGGCTCAGCAGAGAGGAACCGG - Intergenic
1176666303 21:9690506-9690528 CAGTGTCAGCAGAGATCAGCGGG - Intergenic
1176883104 21:14221903-14221925 CTGATACAGCAGAGAGAAACAGG - Intronic
1178746589 21:35256952-35256974 CAGTTTCAGAAGAGAAAAAGGGG + Intronic
1179535708 21:42050118-42050140 GGGTCTTAGAAGAGAGAAACTGG + Intergenic
1183291153 22:37002718-37002740 CACTCTCCGCAGTGAGAATCTGG + Intronic
1183661724 22:39225317-39225339 CAGGCCAAGCAGAGAGACACAGG + Intronic
949540676 3:5029675-5029697 TAGTCCCAGCAGAGAGGAACTGG - Intergenic
950887725 3:16375635-16375657 CAGCCTGAGCAGAGAGATAAAGG + Intronic
951727476 3:25776103-25776125 CAGTCTCAGAAAAGATTAACAGG - Intronic
952970234 3:38646135-38646157 GTCTCTCAGCAGAAAGAAACAGG + Intronic
953998266 3:47536882-47536904 CAGTCTCAGCAGAGAGCTGTGGG - Intergenic
954080045 3:48208194-48208216 CAGACTCTGCTGAGAGAAGCTGG + Intergenic
954098998 3:48355208-48355230 GAGTCTCAGCAGAGAGGGAAAGG - Intergenic
954675328 3:52312253-52312275 CCCTCCAAGCAGAGAGAAACTGG - Intergenic
954807449 3:53228778-53228800 GATTCTCAGCAGAGACAGACTGG + Intronic
957273294 3:78058831-78058853 CACTCTCAGCCAACAGAAACTGG - Intergenic
960052431 3:113251237-113251259 CAGTCGGAGCAGGGAGAGACAGG + Intronic
960432738 3:117589716-117589738 CAGTCTCAGGAGAGAGGACAGGG + Intergenic
960896517 3:122512146-122512168 CAGTCAAAGTATAGAGAAACAGG + Intronic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
964732906 3:159886188-159886210 CAGTCTGGGCAGAAACAAACAGG - Exonic
965491521 3:169342782-169342804 AAATCTCAGTAGAGAGAAAGTGG + Intronic
966035109 3:175402634-175402656 AAGGCTCTGAAGAGAGAAACAGG - Intronic
966676530 3:182596028-182596050 TAGTCACAGAAGAGAGAAGCCGG - Intergenic
968767351 4:2479706-2479728 CTGTCTCAGCAGCGTGAAAACGG + Intronic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969241304 4:5900012-5900034 CTGTCTCAACAGAGAAAAACAGG + Intronic
970756340 4:19431067-19431089 CAGGCTCAAGAGATAGAAACTGG + Intergenic
971545283 4:27878745-27878767 CAATGACAACAGAGAGAAACAGG + Intergenic
971676698 4:29640304-29640326 CAGTCTCAGAAGACAGAACTAGG + Intergenic
971829474 4:31672045-31672067 AAGTCACATCAAAGAGAAACTGG + Intergenic
973927246 4:55751216-55751238 CAGTTGTAGCACAGAGAAACAGG + Intergenic
974189936 4:58491743-58491765 CAGTTTGCACAGAGAGAAACAGG + Intergenic
974550086 4:63361116-63361138 CAGCCACAACAGAAAGAAACAGG - Intergenic
974756864 4:66220659-66220681 CATTCTCAGCAAAGAAACACAGG - Intergenic
976853663 4:89577818-89577840 CAGTCTTTGCAGAGAGGAAGGGG - Intergenic
977025343 4:91811773-91811795 CTGTCTAAGCTGAAAGAAACAGG + Intergenic
977218999 4:94316673-94316695 CATTCTAAGCAGAGAGAAAATGG - Intronic
979215487 4:118159018-118159040 CTGACTCAGCAGAGAGCAACTGG + Intronic
979501046 4:121440075-121440097 CAGTGGCAGCAGAAAGAAACGGG + Intergenic
979857840 4:125656442-125656464 CAGTGACAGAAGAGAGAAATGGG + Intergenic
980062534 4:128147315-128147337 CTGTCTTAGCAGTGAGAAAAAGG - Intronic
980269382 4:130564128-130564150 TAGGCTTAGTAGAGAGAAACTGG - Intergenic
982216395 4:153086060-153086082 CTGTCTCAGGAGAGAGGAGCTGG + Intergenic
983509602 4:168593301-168593323 CAGATCCAGCAGAGAGAAGCTGG - Intronic
984362975 4:178761222-178761244 ATGCCTGAGCAGAGAGAAACAGG + Intergenic
984472278 4:180191689-180191711 GACTCTAAACAGAGAGAAACTGG + Intergenic
984635687 4:182106798-182106820 CAGTATCAGCTGTGGGAAACTGG + Intergenic
985365864 4:189232013-189232035 CCTTCCCAGCTGAGAGAAACAGG - Intergenic
985408718 4:189661830-189661852 CAGTGTCAGCAGAGATCAGCTGG + Intergenic
985899376 5:2776743-2776765 CAGTCTCAGCGCAGAGAAGGCGG + Intergenic
986333686 5:6736915-6736937 CAGTCTCAGCAGAGAGAAACAGG - Intronic
987099392 5:14578878-14578900 AAGCCTCAACAGGGAGAAACAGG + Intergenic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
990667821 5:58093526-58093548 CAGTCTCAGCAAAAAAAGACTGG + Intergenic
990913176 5:60874577-60874599 AAGTTTCAGCAGAGACAAAAAGG + Exonic
990915658 5:60901772-60901794 GAGTACCAGTAGAGAGAAACAGG - Intronic
992461133 5:76961335-76961357 CAGACTCAGGAGAGAGAAGTAGG - Intronic
993085640 5:83360390-83360412 CTCTTTCAGCAGACAGAAACAGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
995277401 5:110292765-110292787 CATTATCAGCAGGGTGAAACAGG + Intronic
995767972 5:115639481-115639503 CAGGATTAGCAGAGTGAAACAGG - Intergenic
997402996 5:133616967-133616989 CAGTAACAGCAGAGGGGAACTGG - Intergenic
997808281 5:136941534-136941556 CAGTCTCAGCAAACTGACACAGG - Intergenic
999417881 5:151415776-151415798 CAGTCTATTCATAGAGAAACGGG - Intergenic
1000030929 5:157400718-157400740 GAGTCTCAGAAGAGAGACAAAGG + Intronic
1000139852 5:158391896-158391918 CAGGATCAGCATAGAGATACAGG - Intergenic
1001649620 5:173306264-173306286 CAGTTTTAGCAAAAAGAAACTGG - Intergenic
1002057384 5:176606265-176606287 CAGGCTGAGCAGATAAAAACAGG - Intronic
1003594400 6:7461503-7461525 CAGGCTCAGCTAAGAGCAACGGG + Intergenic
1003988317 6:11460338-11460360 CAGCATAAGCAGAGAGACACAGG + Intergenic
1005410900 6:25545324-25545346 AGGTATCACCAGAGAGAAACAGG + Intronic
1007763130 6:44145871-44145893 AAGACTGACCAGAGAGAAACTGG - Intronic
1008146360 6:47896320-47896342 CTGCCTCATAAGAGAGAAACGGG - Intronic
1013180989 6:107716915-107716937 CATTCTCAGCAGTGAGACAGAGG - Intronic
1015264980 6:131281766-131281788 TAGACTCAGCAGAGGGAAGCAGG - Exonic
1015908153 6:138138700-138138722 CAGCCTAAGCAGAGAGACAGGGG + Intergenic
1016238962 6:141905599-141905621 CAGCCTGGGCAGAGAGAGACTGG + Intergenic
1017388941 6:153917081-153917103 CATTCTCAGCAGACAAACACAGG - Intergenic
1017589660 6:155965204-155965226 CAGTTTTTGCAGAAAGAAACTGG + Intergenic
1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG + Intergenic
1017811724 6:157988533-157988555 GAGACACAGCAGAGAGACACGGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018663603 6:166113136-166113158 CAGTATCAGCATCGAGAACCAGG - Intergenic
1018971132 6:168530210-168530232 CAGCCACAGCGGAGGGAAACGGG + Intronic
1019220947 6:170472366-170472388 CAGCCTCAGCAGACAGTAGCTGG - Intergenic
1019433139 7:1008603-1008625 CAGCCTCAGCTCCGAGAAACAGG + Intronic
1019697716 7:2456181-2456203 CAGTCCCAGGAGAGAAAAAGGGG - Intergenic
1023879527 7:44310307-44310329 AAGTCTCAGAAGAAAGAAATGGG + Intronic
1028871290 7:95773321-95773343 TTTTCGCAGCAGAGAGAAACTGG - Intronic
1029638785 7:101804929-101804951 CAGTCTAAGCAGCTAGAAAAGGG - Intergenic
1029813203 7:103069523-103069545 CAGTCTGAGGAGACAGAGACTGG + Intronic
1029928535 7:104345482-104345504 AAATCTCAGCATAGATAAACAGG - Intronic
1030124911 7:106144464-106144486 CATTCTCACCAGTGAGAATCAGG - Intergenic
1030229189 7:107187919-107187941 CATTATCAGGAGAGAGGAACTGG - Intronic
1031078653 7:117237961-117237983 CAGACTGAGCAGACAGGAACTGG + Intergenic
1031187496 7:118501343-118501365 TAGTTTCAGCAGAGATGAACAGG - Intergenic
1031299998 7:120053590-120053612 CAGCCTCAAAAGAGAGAATCAGG + Intergenic
1031463514 7:122080502-122080524 AAGTATCTGCAGAGAGAACCTGG - Intronic
1032689177 7:134265677-134265699 CTGTCCCAGCAGAGAGAAGGAGG - Intergenic
1032791059 7:135242729-135242751 CAGTCTCTGCAGTGAGAGGCTGG + Intronic
1034006201 7:147474717-147474739 CAGTCTCACAAGAAAGAACCAGG + Intronic
1034555888 7:151850129-151850151 CAGTGTCTGCAGAAAGAAGCGGG + Intronic
1034719756 7:153280327-153280349 GTATCTCAGCAGAGAGAAGCTGG + Intergenic
1035045796 7:155964563-155964585 CAGACTCAGCAGGGAGCACCTGG + Exonic
1035246603 7:157566484-157566506 CAGTCTCAGGAGAGATCAAAGGG - Intronic
1035829029 8:2674802-2674824 CAGTGACAGCAGAGAGACCCAGG - Intergenic
1036438194 8:8755533-8755555 CACTCTCAGCAAACAGAACCAGG + Intergenic
1036990231 8:13584235-13584257 CAGCCTCAGAAGAGCCAAACAGG - Intergenic
1038101199 8:24378071-24378093 CATTCTCAGCAAAGTAAAACAGG + Intergenic
1038920684 8:32080669-32080691 CAGACTCAGCAGATAGGAACAGG + Intronic
1040745262 8:50634356-50634378 AAGTCTCAGCAGAGGGCATCCGG - Intronic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1042572814 8:70185059-70185081 CTGTGTCTGTAGAGAGAAACTGG - Intronic
1042652119 8:71054468-71054490 TAGTGTCAGCAGAGAAAAACAGG - Intergenic
1043745113 8:83865478-83865500 CACTCACAACAGAGAGAAAGAGG - Intergenic
1043909107 8:85839833-85839855 TAGTCTCAGCAGTGTGAAAATGG + Intergenic
1044069109 8:87734015-87734037 CAGTCTAATCAGAGAAACACCGG + Intergenic
1044812594 8:96079426-96079448 CAGCCCCAACAGAGAGGAACAGG - Intergenic
1045788474 8:105953966-105953988 CATTCTCAGCAAACTGAAACAGG - Intergenic
1047515867 8:125554483-125554505 CTTTCTAAGCAGAGAGAAAGAGG + Intergenic
1047523253 8:125611916-125611938 CAGTCCCAGCCCAGAGAAACAGG - Intergenic
1048141992 8:131803719-131803741 CAGTCTGAGCACTGAGACACAGG - Intergenic
1048223941 8:132566898-132566920 CTCTTTCAGCAGAGTGAAACTGG - Intergenic
1053143748 9:35698169-35698191 CAGCCTGGGCAGAGAGAAAGTGG + Exonic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057633779 9:96743233-96743255 CAGTCTCAGCAGTGTGAGAATGG + Intergenic
1058581489 9:106463413-106463435 GAGTCTCTGGAGAGAGAAAATGG - Intergenic
1059819867 9:117960249-117960271 CAGGCTCAGCATAGAGAAATGGG - Intergenic
1060070235 9:120540786-120540808 CACTCTGATCAGAGAGGAACAGG - Intronic
1060707378 9:125816327-125816349 CAGTCCTATCAGAGGGAAACTGG + Intronic
1061794351 9:133076582-133076604 CAGTCTCCAAAGAGAGAATCTGG + Intronic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1062385195 9:136306561-136306583 CAATCCCACCAGAGAAAAACAGG + Intronic
1203740762 Un_GL000216v2:175426-175448 CGTTTTCAGCAGAGAGAAACTGG - Intergenic
1203659798 Un_KI270753v1:31255-31277 CAGTGTCAGCAGAGATCAGCGGG + Intergenic
1187132597 X:16517212-16517234 CAGTCGCAGCAGAAAGAAACAGG + Intergenic
1190018455 X:46850028-46850050 CAGTCTGAGCAGACTAAAACAGG + Intronic
1190763756 X:53459029-53459051 CAGTACCTGCAGAGAGACACAGG + Intergenic
1193041943 X:77013391-77013413 CAATCTCTGCAGTGAGACACTGG - Intergenic
1194228666 X:91294758-91294780 CATTCTCAGCAGACAAACACAGG - Intergenic
1195215622 X:102698555-102698577 CTGTCTTAGCAGGGATAAACTGG + Intergenic
1196759176 X:119185436-119185458 CATTCTCAGCAGAGTAACACAGG - Intergenic
1200835450 Y:7727347-7727369 CAGCCTGAGCAGAGAGATAAAGG + Intergenic
1200878246 Y:8182717-8182739 AAGTCTGAGCACAGTGAAACTGG - Intergenic