ID: 986333845

View in Genome Browser
Species Human (GRCh38)
Location 5:6738187-6738209
Sequence CAGCCTTCCCTACTGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986333844_986333845 -9 Left 986333844 5:6738173-6738195 CCGGCTCTATTCAGCAGCCTTCC 0: 1
1: 0
2: 0
3: 18
4: 169
Right 986333845 5:6738187-6738209 CAGCCTTCCCTACTGCTGACTGG 0: 1
1: 0
2: 3
3: 23
4: 179
986333842_986333845 -3 Left 986333842 5:6738167-6738189 CCCTGGCCGGCTCTATTCAGCAG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 986333845 5:6738187-6738209 CAGCCTTCCCTACTGCTGACTGG 0: 1
1: 0
2: 3
3: 23
4: 179
986333843_986333845 -4 Left 986333843 5:6738168-6738190 CCTGGCCGGCTCTATTCAGCAGC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 986333845 5:6738187-6738209 CAGCCTTCCCTACTGCTGACTGG 0: 1
1: 0
2: 3
3: 23
4: 179
986333841_986333845 -2 Left 986333841 5:6738166-6738188 CCCCTGGCCGGCTCTATTCAGCA 0: 1
1: 0
2: 0
3: 3
4: 95
Right 986333845 5:6738187-6738209 CAGCCTTCCCTACTGCTGACTGG 0: 1
1: 0
2: 3
3: 23
4: 179
986333840_986333845 2 Left 986333840 5:6738162-6738184 CCTGCCCCTGGCCGGCTCTATTC 0: 1
1: 1
2: 2
3: 34
4: 348
Right 986333845 5:6738187-6738209 CAGCCTTCCCTACTGCTGACTGG 0: 1
1: 0
2: 3
3: 23
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986333845 Original CRISPR CAGCCTTCCCTACTGCTGAC TGG Intronic
900149157 1:1170749-1170771 CAGCCCTCGCTCCTGCTGGCCGG - Intergenic
900254566 1:1691343-1691365 CATCCTTCCCTTCTGCTGTCTGG + Exonic
900263318 1:1744618-1744640 CATCCTTCCCTTCTGCTGTCTGG + Intronic
901858377 1:12058713-12058735 CAGCCTTCCCTCCTGCCCATGGG + Intergenic
903561347 1:24230373-24230395 CTGCCTTCCCACCTCCTGACTGG - Intergenic
903888089 1:26552738-26552760 CAGCCTCCCAAACTGCTGGCTGG + Intronic
904030918 1:27532971-27532993 CACGCTTCCTGACTGCTGACGGG - Intergenic
906256534 1:44354997-44355019 CAGCCTCTCCCGCTGCTGACGGG - Exonic
907011552 1:50968450-50968472 CGGCCTGCCCTTCTGCTGGCGGG - Exonic
908057088 1:60299316-60299338 CAGCCATCCCTACTGAGAACTGG + Intergenic
911690710 1:100830732-100830754 CACCCCTCCCTGCTGCTGACAGG + Intergenic
916039622 1:160950963-160950985 CAGCCCTCCCTCCTGCAGGCTGG + Intronic
916260530 1:162837543-162837565 CAGACTTCCCTACTGCTGCCTGG + Intronic
916278699 1:163024117-163024139 TGGCCTTCCCCACTGCTGAGTGG - Intergenic
920387574 1:205579733-205579755 CACCCTTCCCTCCTGCAGCCTGG + Exonic
920872284 1:209805015-209805037 CACCCTTCCCTTCTGCTGGATGG + Intronic
921367407 1:214386774-214386796 AAGCCTTCTTTACTGCTTACTGG + Intronic
922842058 1:228650577-228650599 CTGCCTGCCCTCCTGCTGGCGGG + Intergenic
923095952 1:230775277-230775299 CAGGCAGCCCTACTGCTCACAGG + Intronic
923504018 1:234590126-234590148 CAGGCTTCCCTCCTGCTTACAGG - Intergenic
924139177 1:241004253-241004275 CAGCCTTTCTTACTGCTGCTTGG + Intronic
1063448727 10:6136864-6136886 CAGCCTTCCCTGCAGCTAAGGGG + Intergenic
1065241159 10:23706857-23706879 CCCTCTTCCATACTGCTGACTGG - Intronic
1068741747 10:60481381-60481403 CAGCCTTACATTCTGCTGCCTGG + Intronic
1070811160 10:79298751-79298773 CAGCCTTTCTTACTGCTGCCTGG + Intronic
1070955789 10:80462496-80462518 CAGCCTTTCCTGCTGCTGAGGGG - Intronic
1071015317 10:80990081-80990103 GAGTCTTCCCTACTGGTGAGGGG - Intergenic
1071120050 10:82266429-82266451 CAGCCTTCAGTACTGCTCACAGG - Intronic
1073117850 10:101102179-101102201 AAGCCTTGGCAACTGCTGACAGG - Intronic
1074490723 10:113937111-113937133 CAGCCTTGCCCACTGATGGCAGG + Intergenic
1075299335 10:121307413-121307435 CATCCTTCCCTTCTGCTCCCTGG + Intergenic
1077190748 11:1255133-1255155 CAGCCATCCTTTCTGCTGTCGGG - Exonic
1078481353 11:11678733-11678755 CAGCCTTCTCTACTGATGCCAGG - Intergenic
1078655162 11:13231892-13231914 CAGGCTTCCCCATGGCTGACAGG + Intergenic
1078663388 11:13304899-13304921 CAGACCTCTCTACTGCAGACAGG + Intronic
1078663650 11:13306879-13306901 CAGACCTCTCTACTGCAGACAGG + Intronic
1079667060 11:23119566-23119588 CAGTTTTCCCATCTGCTGACTGG - Intergenic
1080669093 11:34359230-34359252 CAGCCTCCCCCACTCCTGAATGG + Intergenic
1080807410 11:35666638-35666660 CAGCCTTCCATATAGCTGACAGG - Intronic
1082082816 11:48025421-48025443 CAGCCCTGCCTACTGCTCAGAGG - Intronic
1083809766 11:65096925-65096947 CAGCCTTGCCTGCAGCTGATAGG - Intronic
1083991406 11:66248029-66248051 CAGCCTTAACTCCTGGTGACTGG - Intergenic
1084432781 11:69120778-69120800 CAGCCTTCGTGACTGCAGACGGG - Intergenic
1085702025 11:78754253-78754275 GTGTCTTCCCTACTGCTGAGGGG + Intronic
1085803388 11:79612179-79612201 CAGTCTTCCCTTGTGCTGACTGG + Intergenic
1086203739 11:84234095-84234117 CTCCCCTCCCAACTGCTGACAGG + Intronic
1087664761 11:101031374-101031396 CTGCCTTCCCAGCTGCTGTCTGG + Exonic
1088358769 11:108969674-108969696 CAGCCTACCCTACAGGTCACAGG + Intergenic
1089059949 11:115618377-115618399 CAGCCTTCCAAAGTGCTGGCTGG + Intergenic
1089613156 11:119680891-119680913 CAGCCTTCCCAACTCGTGGCTGG - Intronic
1090207689 11:124895039-124895061 TAGCCCTTCCTACTGCTGCCAGG - Intronic
1091917523 12:4280576-4280598 CTTCCTTCCCTTCTGCTGTCTGG + Intronic
1093945010 12:25098517-25098539 CAGCCTTCCCCACTGTAGATGGG + Intronic
1094672841 12:32587642-32587664 CAGCCTCCCAAAGTGCTGACAGG + Intronic
1095416201 12:41979470-41979492 CAGTCTTCCCTGATGCTCACTGG + Intergenic
1098172863 12:67764205-67764227 CAGCCTTCCCTACCCCATACAGG - Intergenic
1099924215 12:88997763-88997785 CAGTCTTCCCTCCTGATGATAGG + Intergenic
1101762243 12:107668524-107668546 CAGTCTTCCCTCCTGCAGAATGG + Intergenic
1102168568 12:110824860-110824882 CTGCCTTCCCTCCTGCTGTGTGG + Intergenic
1105634359 13:22203106-22203128 CTGCCTCCTCTACTGATGACAGG - Intergenic
1105705164 13:22963819-22963841 GAGCCTCGCCTGCTGCTGACGGG + Intergenic
1110153245 13:72281166-72281188 CAATCTGCCCTAATGCTGACTGG + Intergenic
1119320756 14:73728855-73728877 CAGCCTTCTGTACTGCTTCCTGG - Intronic
1119761091 14:77152450-77152472 CAGCCCTCCAAACTGCTGAGAGG + Intronic
1119914932 14:78389456-78389478 AAGCCTTCATTACTGCTGAGGGG + Intronic
1120540825 14:85748204-85748226 GACCCTTGCATACTGCTGACGGG - Intergenic
1120975899 14:90248055-90248077 CATGCTTCCCTTCTGCTGCCAGG - Intergenic
1123983639 15:25625031-25625053 CAGCCTTCCCCTCAGCTGCCCGG - Intergenic
1124218829 15:27832083-27832105 CAGCCTCACCAACTGCGGACTGG + Intronic
1125018519 15:34961726-34961748 CTGCCTTCACTACTGATGGCTGG + Intronic
1125688644 15:41578866-41578888 CATGCTTCCCTGCAGCTGACCGG + Exonic
1128690776 15:69723357-69723379 CAGCCTTCCCTACAGCGTAGAGG - Intergenic
1129888761 15:79057213-79057235 CAGCCATCCCTGCTGCAGGCTGG + Intronic
1130044108 15:80430803-80430825 CAGGCTGCCCAACTGCTGTCAGG - Intronic
1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG + Intergenic
1131094228 15:89645786-89645808 GAGGCTTCCCCACTGCTGTCAGG + Intronic
1132040650 15:98522326-98522348 AAGCCTTCCCTACGCCTTACTGG + Intergenic
1138132092 16:54488990-54489012 CAGCCTTGCCTACTGCCTCCTGG + Intergenic
1138249432 16:55490636-55490658 CAGGCTTGCCTAATTCTGACAGG - Intronic
1138611350 16:58127823-58127845 CAGAGTTCCCTAGTGGTGACAGG + Intronic
1140925150 16:79575442-79575464 CACTCTTAGCTACTGCTGACTGG + Intergenic
1141823513 16:86463682-86463704 CAGCCCTCCCAGCTGCTGCCTGG - Intergenic
1142792632 17:2279901-2279923 CAGCCTTCCCTAACCATGACTGG + Intronic
1143995885 17:11006075-11006097 CAGCCCTCCCTACTGCAGCCTGG + Intergenic
1144074921 17:11708698-11708720 CAGTCTTCCCTACTGCAGTGAGG + Intronic
1144370463 17:14585325-14585347 CAACCAACCCTACTGCTGATTGG + Intergenic
1144754157 17:17669334-17669356 CAGCCTTCCCTTCTGCTCAGTGG - Intergenic
1145987191 17:29054938-29054960 CAGCCTTCCCCACTCCTGGCAGG - Intronic
1148136076 17:45292787-45292809 GAGCATTCCCTACTGCTGTTAGG - Intronic
1148161835 17:45454545-45454567 ACGCCTTCCCTCCTGCTGCCAGG + Intronic
1148319046 17:46733673-46733695 TAGCCTTCCCAACAGCTGGCAGG + Intronic
1148973982 17:51510734-51510756 GACCCTTGCCTACTGTTGACAGG + Intergenic
1149663864 17:58352306-58352328 CAGCCTCCCCGCCTGCTGGCGGG - Intronic
1152790832 17:82278557-82278579 CAGCCTTCCTCACTTCTGATGGG - Intergenic
1152934892 17:83130672-83130694 CAGCCTCGCCTGCTGCTGGCGGG - Intergenic
1155685219 18:28540131-28540153 CAGGCTTCTCTCCTGCTGAGGGG + Intergenic
1160690738 19:459922-459944 TAACCTTCCCCTCTGCTGACGGG - Intronic
1160711332 19:552515-552537 CAGCCGTGACTCCTGCTGACTGG - Intergenic
1162243539 19:9379075-9379097 CAGCCTTACCTACTGAGGCCAGG - Exonic
1162253756 19:9470383-9470405 CAGACTTACCTACTGAGGACAGG + Exonic
1163648529 19:18503798-18503820 GAGCCTTCCCTGCTGCAGGCTGG + Intronic
1164485012 19:28648298-28648320 CAGCTTTGCCTTCTACTGACAGG - Intergenic
1164865530 19:31601324-31601346 CAGCCTTCCCAACCACCGACAGG - Intergenic
1165078273 19:33292844-33292866 TGGCCTTGCCTCCTGCTGACTGG - Intergenic
925853819 2:8110260-8110282 CAGCCTTCCCCAGGGATGACTGG - Intergenic
928126263 2:28618645-28618667 CCGCCTTCCCCACTGTTCACAGG + Intronic
929894131 2:45943797-45943819 CAGCCTCCCCTGCTGCTGTCTGG - Intronic
931223177 2:60306549-60306571 AAGCCTTGTCTACTGCAGACAGG - Intergenic
932939363 2:76144244-76144266 CAGGCTTCCCAGCTGCTGAAAGG - Intergenic
933946623 2:87291857-87291879 CAGCCACTCTTACTGCTGACAGG - Intergenic
933983072 2:87569398-87569420 CAGCATTCTCAACTGCAGACTGG - Intergenic
934037199 2:88098145-88098167 CAGCCTTCCCTCCTGGAGACTGG + Intronic
934702752 2:96455060-96455082 CAGGCCTCCTTAGTGCTGACAGG - Intergenic
935205772 2:100895558-100895580 CAGCCACCCCTGCTGCTGGCAGG - Intronic
936310773 2:111381396-111381418 CAGCATTCTCAACTGCAGACTGG + Intergenic
936333569 2:111569684-111569706 CAGCCACTCTTACTGCTGACAGG + Intergenic
937023427 2:118678942-118678964 AAGCCTTCCTTAGTGCTGAAGGG + Intergenic
937471643 2:122178879-122178901 CATCCTCCCCTACAGCTCACTGG + Intergenic
937588864 2:123590237-123590259 CTGCCTTCCTTACTGCAGACTGG - Intergenic
940888426 2:159011820-159011842 CAGCCTGCCCTCCTGCTTCCTGG + Intronic
945065730 2:205946353-205946375 CAGCCATCCCCACTGCAGTCAGG - Intergenic
946253959 2:218430054-218430076 CAGCCTTCCCTGCCTCTGCCTGG - Intronic
947795551 2:232891861-232891883 CAGCCTGCACTATTTCTGACAGG + Intronic
948418027 2:237831164-237831186 CAGCCCTTCCTAATCCTGACAGG + Intronic
1169657676 20:7942997-7943019 CAGACTTCCCTACTCCTCATTGG + Intergenic
1170039517 20:12025391-12025413 TAGCCTTCCCTACAGGAGACTGG + Intergenic
1171981675 20:31633187-31633209 CTGCCATCCCTCCTGCTGGCAGG + Intergenic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1175403876 20:58714999-58715021 GAGCCTTCCATGCTGCTGGCTGG - Intronic
1176052317 20:63126379-63126401 CAGCCCTACCTGCTGCTGCCAGG - Intergenic
1179902685 21:44402125-44402147 CATCCTTCCCTCCTGGAGACCGG + Intronic
1181033774 22:20160340-20160362 CAGTCTTCCCATCTGCCGACGGG + Intergenic
1184228586 22:43145192-43145214 CAGCCTTCCCCACTCCTGGGAGG - Intergenic
953194672 3:40721120-40721142 CAGCCTTCCCTGATGCAAACGGG - Intergenic
953300293 3:41767755-41767777 CAGCCTTTCCTACAGCTGGTAGG + Intronic
958419620 3:93915563-93915585 CAGCCTTCCCTACAGCCCTCAGG + Intronic
968691935 4:1995082-1995104 GGGCCCTCCCTACTGCTGAGTGG + Intronic
972628467 4:40823008-40823030 CAGCCTGCCCCACAGCTGCCCGG - Intronic
974594385 4:63997454-63997476 CATGCCTCCCTTCTGCTGACAGG + Intergenic
977912594 4:102555235-102555257 CAGCCTTTCCTAATGTTGCCTGG + Intronic
977953151 4:102997045-102997067 CAGCCTCCCATAGTGCTGACAGG + Intronic
979282112 4:118879908-118879930 CAGACCTCCATGCTGCTGACAGG - Intronic
980638026 4:135535502-135535524 GAGCTTTGACTACTGCTGACAGG + Intergenic
980652674 4:135740033-135740055 CCGCCTCCCACACTGCTGACAGG + Intergenic
981011489 4:139929905-139929927 CAGACTTCCTTATAGCTGACGGG - Intronic
982127367 4:152196117-152196139 CAGCAGACCCTACTGCTCACGGG - Intergenic
984536437 4:180981665-180981687 CAGCCTGCCCAACTGTGGACAGG + Intergenic
985070055 4:186158738-186158760 CAGCCGTCCCTACTGCAGACTGG + Intronic
985886454 5:2683905-2683927 CAGCCCTCCCTGCTGCTGCCAGG + Intergenic
985993484 5:3583132-3583154 CAGCCTCACCTACTGCTCACTGG + Intergenic
986333845 5:6738187-6738209 CAGCCTTCCCTACTGCTGACTGG + Intronic
994185532 5:96811003-96811025 CAGCCTTGCCCACTGCTATCCGG + Intergenic
1000627245 5:163553361-163553383 CAGCCTCCCCTACTATTGACAGG + Intergenic
1002318616 5:178361849-178361871 GAGCCTGCCCGCCTGCTGACTGG - Intronic
1002344978 5:178542505-178542527 CAGCCATCCCTCTGGCTGACCGG + Intronic
1003095116 6:3136424-3136446 CTGCCTTTGCTTCTGCTGACTGG - Intronic
1006030549 6:31173894-31173916 CAGCCTTCCCTTCCCCTCACTGG + Intronic
1007339676 6:41182767-41182789 CACCCTTCCCCACAGCTGACTGG + Intergenic
1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG + Intronic
1012532328 6:100252518-100252540 CAGGATTCCCTAATGCTGTCTGG - Intergenic
1012607938 6:101181485-101181507 CAGCCTACCCAAATGCTGAGAGG + Intergenic
1013677070 6:112477005-112477027 CATCCTTCCCCATTGGTGACTGG - Intergenic
1014874432 6:126639602-126639624 CAGCCTACCCTACTGCTAGAAGG - Intergenic
1014945935 6:127497559-127497581 CAGCCTTTCCTACTTCAAACAGG + Intronic
1016998292 6:149976582-149976604 TGGCCTTCCCTCCTCCTGACAGG + Intergenic
1021329335 7:19315858-19315880 AATCCTTCCCCACTGCAGACAGG + Intergenic
1023675340 7:42622882-42622904 CACCCTTTCCTACAGCTGTCAGG + Intergenic
1024242737 7:47448022-47448044 CAGCCTCCCCTCCTTCTGCCAGG - Intronic
1029234436 7:99101814-99101836 CAGCCTTCCCAATAGCTTACAGG - Intronic
1030250306 7:107436123-107436145 CATCCTTCCCAACTTCTGTCTGG - Intronic
1032427308 7:131832371-131832393 CAGCCTTCTGTCCTGCTGGCAGG + Intergenic
1032832540 7:135642438-135642460 CAGCCTTCCAAATTGTTGACAGG + Intronic
1034776886 7:153835980-153836002 CAGCTTTACTTCCTGCTGACGGG - Intergenic
1036650480 8:10639231-10639253 GAGCCTTTCCCACTGTTGACGGG - Intronic
1037538663 8:19851337-19851359 TATGCATCCCTACTGCTGACTGG - Intronic
1037902338 8:22695212-22695234 CAGCCTGCCCTGATTCTGACCGG - Intergenic
1039178702 8:34838863-34838885 CAGCCATCCCTTGTGCTGATTGG - Intergenic
1039316139 8:36374698-36374720 CAGGCTGCCCTGCTGCTGAAGGG - Intergenic
1041988116 8:63951586-63951608 ATGCTTTCCCAACTGCTGACAGG - Intergenic
1047211086 8:122841108-122841130 CAGCATTACGTACTGCTGCCAGG + Intronic
1049612915 8:143563759-143563781 CAGCCTTCCCCACTTCTGTCAGG + Intergenic
1049815232 8:144596136-144596158 CAGCCGTCCCCTCTGCTGCCAGG - Intronic
1051057960 9:13010034-13010056 GAGCCTCCCTGACTGCTGACTGG + Intergenic
1053009927 9:34627344-34627366 CTGCCTTCCCTACACCTGGCTGG + Intronic
1053281380 9:36821911-36821933 GACCCTTCCCAACTGCTGGCAGG + Intergenic
1053618198 9:39791542-39791564 CAGCCTTCCCTTATGCTGCTGGG + Intergenic
1053876372 9:42550912-42550934 CAGCCTTCCCTTATGCTGCTGGG + Intergenic
1053896299 9:42743783-42743805 CAGCCTTCCCTTATGCTGCTGGG - Intergenic
1054265958 9:62915887-62915909 CAGCCTTCCCTTATGCTGCTGGG - Intergenic
1056826417 9:89879305-89879327 CTGCCTTCCCTCCTGCCAACAGG + Intergenic
1058265806 9:102897780-102897802 CAGGCTTCCTTAGTGCTGTCGGG - Intergenic
1059919468 9:119141831-119141853 CAGCATTCCCCACTGCCCACAGG - Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062040059 9:134400448-134400470 CAGCCTTCCCATCTGCAGAATGG - Intronic
1186095427 X:6096315-6096337 CAGCCTTCCCTACAGATTAGAGG + Intronic
1187895133 X:23973561-23973583 GAGCCTCTCCTACTGCAGACAGG - Intergenic
1187913857 X:24134838-24134860 GAGCCTCTCCTACTGCAGACAGG - Intergenic
1188114113 X:26223032-26223054 AAGACTTCCCTTTTGCTGACTGG - Intergenic
1189467209 X:41286314-41286336 CAGCCTCCCCTGCAGCTGAGTGG - Intergenic
1190218108 X:48493444-48493466 CAGGCTTCCCCCATGCTGACTGG - Intergenic
1192369717 X:70503420-70503442 CTGCTTTCCCTTCTGCTGACAGG - Exonic
1192733790 X:73828912-73828934 CAGTCTTCCATATTACTGACTGG - Intergenic
1193968726 X:88023119-88023141 CTCCCTTCCCAACTGCTGGCAGG - Intergenic
1195218083 X:102720559-102720581 CAGCCTTCCTTCCAGCTGTCTGG + Intergenic
1198104611 X:133450473-133450495 CAGCCTTCCAGCCTGGTGACAGG - Intergenic
1199276307 X:145946624-145946646 CAGCCTGGACTAGTGCTGACTGG + Intergenic