ID: 986333940

View in Genome Browser
Species Human (GRCh38)
Location 5:6738855-6738877
Sequence CTGTGGTTACAGAGGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986333936_986333940 -6 Left 986333936 5:6738838-6738860 CCAGCTAAAGGAAAAGACTGTGG 0: 1
1: 0
2: 1
3: 15
4: 173
Right 986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG 0: 1
1: 1
2: 2
3: 36
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986333940 Original CRISPR CTGTGGTTACAGAGGGAAAT TGG Intronic
900731778 1:4266727-4266749 CTGTGGTTTCAGGGTGCAATTGG - Intergenic
903757289 1:25671427-25671449 TTGGGGATACAGAGGGGAATAGG + Intronic
904621322 1:31777036-31777058 CTGAGGTCACAGAGGTATATAGG + Intergenic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905090369 1:35426260-35426282 CTTGGGTTAAAAAGGGAAATGGG - Intergenic
905618718 1:39421433-39421455 CTCTGATTACAAAGGGAAATGGG - Intronic
906787526 1:48628982-48629004 CTGGGGTTACAGAGATTAATAGG - Intronic
907041004 1:51259309-51259331 CTGAGGTTAGAGAGGAAAAGGGG - Intronic
907819344 1:57951947-57951969 CTTTGGTTTCAGAGGGCAAAAGG + Intronic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
908769960 1:67586984-67587006 CTGAAGTTAGAGAGAGAAATGGG - Intergenic
908965553 1:69757788-69757810 CTGTGGATACAGAAGCAAATGGG + Intronic
909670657 1:78184686-78184708 CTGAGGTTACATAAGGAAAGTGG - Intergenic
910243835 1:85117846-85117868 TTGTGGGAACAGAGGTAAATTGG + Exonic
910438895 1:87232178-87232200 CTGTGGGTACAGATGGTAGTAGG - Intergenic
912087104 1:106021524-106021546 TTGTAGGTACAGAGGTAAATTGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913330239 1:117661300-117661322 TACTGGTTACAGAGGGAAAGAGG - Intergenic
914876192 1:151514049-151514071 CTTTGGTTACAGAGGACAGTGGG - Intronic
915027475 1:152844228-152844250 CTGTGTTTACAGATGTAAGTGGG + Intergenic
916907069 1:169297429-169297451 ATGAGGTTACAGAGGTAATTAGG - Intronic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
917865570 1:179191012-179191034 CTGTGGTTAGAAGGGGAAGTGGG - Intronic
918898494 1:190380247-190380269 ATGTGGTTAATGAGGGAAAGTGG + Intronic
919497282 1:198288729-198288751 CTGTGGTGACAGAAGTAAACAGG - Intronic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
919764988 1:201121196-201121218 CTGTGGTTCCATTGGGAATTTGG - Intronic
920020351 1:202951029-202951051 CTGTGGTGGCACAGGGGAATGGG - Exonic
921009941 1:211131944-211131966 CTATGATTACAGAGGGAAAGTGG + Intronic
922885684 1:229018811-229018833 CTGTGGTTGCAAAGGGAGAATGG + Intergenic
922997587 1:229977000-229977022 TGGTGGTGACAGAGGGAAGTAGG + Intergenic
923121997 1:231000835-231000857 CTGTGGTTACAGGGGTGAATAGG + Intergenic
1064847185 10:19668265-19668287 CTGTGGTGACAGTGGGAGTTTGG - Intronic
1064994234 10:21282384-21282406 CTTTGGTCACAGAGGCAAAAGGG + Intergenic
1065233619 10:23624128-23624150 CTTTGGTTTCAAAGGTAAATAGG - Intergenic
1065489781 10:26271203-26271225 CTGTATTTAGAGAGGAAAATAGG + Intronic
1067206893 10:44225623-44225645 CTCAGGTTACAGATGGCAATGGG + Intergenic
1070237663 10:74646494-74646516 CTGTAGTTAAAGAGAGAAAATGG + Intronic
1073758004 10:106601716-106601738 CTGTGGTCACACAGGGACACTGG + Intronic
1076493548 10:130880898-130880920 ATGTGTTTACCGAGGGAAATTGG - Intergenic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077704333 11:4469748-4469770 CTGAGTTTACAGAAGGGAATAGG + Intergenic
1078109599 11:8381988-8382010 CTGTGGTTACAGAGGGATATGGG - Intergenic
1078136651 11:8657543-8657565 CTGTGGCTACAGAGGTAATCAGG - Intronic
1078550537 11:12277184-12277206 CTGGGGTGACAGAGGGCTATTGG + Intronic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1079702286 11:23563708-23563730 GTGTGGTTTGGGAGGGAAATTGG - Intergenic
1084423707 11:69072988-69073010 GTGTGGTTAAAGAGGTAACTGGG + Exonic
1085272206 11:75277085-75277107 CTTTGGTTATGGAAGGAAATGGG - Intronic
1085495046 11:76961247-76961269 CTGTGGTGACAAACTGAAATTGG + Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085907169 11:80777466-80777488 CTGTGGTTGTAGTGGGAAAATGG - Intergenic
1086130259 11:83394026-83394048 CTGGGCTTACAGAGTGAAATGGG + Intergenic
1086289427 11:85290536-85290558 GTGGGGTTAAAGAGGGGAATAGG + Intronic
1087990234 11:104740295-104740317 CTGTGGTTAGATAAGGAGATGGG + Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090517878 11:127448140-127448162 GTGTGGCTAGAGAAGGAAATTGG - Intergenic
1090800642 11:130169489-130169511 CTGTGGTTACAGAAGGCCATGGG + Intronic
1091032078 11:132199546-132199568 CTATGGATACAGAGGGGAAGAGG - Intronic
1094397062 12:30018970-30018992 ATGTGGTTACAGTCAGAAATGGG + Intergenic
1095118494 12:38385052-38385074 CTGTGGTTGCTGTGGGGAATGGG + Intergenic
1095155755 12:38851817-38851839 ATGAGGTTAGAGAGGAAAATAGG - Intronic
1096443873 12:51670631-51670653 CTGTGCTTAGAGAGGTGAATGGG + Intronic
1096755233 12:53793937-53793959 CCGTGGTTATAGAAAGAAATAGG - Intergenic
1097520064 12:60656246-60656268 CTGAGTTCACAGAGGGTAATGGG - Intergenic
1097746749 12:63311634-63311656 CTGGGCTTACAGAGGGAGAAAGG + Intergenic
1097980843 12:65736765-65736787 TGGTGATTACAAAGGGAAATTGG + Intergenic
1098498112 12:71160316-71160338 CTGTAGGTACAGAGGTGAATAGG - Intronic
1099420280 12:82449811-82449833 CAGTGGTTAGAGGGGAAAATTGG - Intronic
1099610001 12:84856738-84856760 TGGTGGTTACAGAAGGCAATGGG - Intergenic
1102605762 12:114066146-114066168 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1104469114 12:129014837-129014859 CTTTGGCTGCAGAGGGAATTTGG + Intergenic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1104685681 12:130782655-130782677 GTGTGGTTTCAGAGGGAGCTGGG - Intergenic
1104970347 12:132528098-132528120 CTGGGGCTCCAGAGGGAAAGCGG - Intronic
1106371766 13:29141479-29141501 TTGTGGTTACAGAAGCACATAGG + Intronic
1106674129 13:31939768-31939790 GTGTCTTTAGAGAGGGAAATGGG + Intergenic
1106870762 13:34017228-34017250 ATATGGTTCCAGAGGGAAAACGG - Intergenic
1107014451 13:35697071-35697093 ATGTGGTCACCGAGGGAAAGGGG - Intergenic
1109319510 13:60792614-60792636 CTGTGGGACCAGAGTGAAATGGG - Intergenic
1109388439 13:61664382-61664404 TTGTCTTTACTGAGGGAAATTGG - Intergenic
1112542319 13:100327232-100327254 ATGTGGTTACACTGGGAAAGGGG - Intronic
1113156680 13:107330670-107330692 CCATAGTTACAGAGGGATATTGG + Intronic
1116015285 14:39399472-39399494 CTGTGGTTACATATGCAAGTAGG - Exonic
1116057975 14:39886543-39886565 CAGTGGTTACAGAGGGCCTTGGG + Intergenic
1116352617 14:43885002-43885024 CTAGAGTTACAGAGTGAAATAGG + Intergenic
1118049046 14:62005890-62005912 CTGTGGTGGCAGTGGGAATTGGG + Intronic
1118114439 14:62759451-62759473 CTGTGCTTACAGAAGGATATTGG + Intronic
1119028140 14:71169923-71169945 CTCTGGTTAAAGATGGAAACTGG - Intergenic
1119134916 14:72208581-72208603 CTGGAGATACAAAGGGAAATAGG - Intronic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1121093924 14:91202675-91202697 CTGTGGCTACAGGGGCAAACAGG + Intronic
1121440307 14:93944699-93944721 CTTGGGGGACAGAGGGAAATGGG + Intronic
1121910161 14:97782795-97782817 CTGTGGATACAGAGAGTAAATGG + Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122393717 14:101407965-101407987 CTGGGGGTACAGAGAGAAATTGG - Intergenic
1125831296 15:42718731-42718753 CCCTGGGGACAGAGGGAAATGGG - Exonic
1126399572 15:48255788-48255810 CTGTGGATAAAGGAGGAAATTGG - Intronic
1128139039 15:65286189-65286211 CTGTGGTTCCACAGGGCACTTGG + Intronic
1128612441 15:69084764-69084786 ATGTGATTAGAGAGGGAAAGAGG - Intergenic
1128885858 15:71287246-71287268 TTGTCTTTACAGAAGGAAATGGG + Intronic
1129445764 15:75616758-75616780 CTGTGGTACCATAGGGAAAGAGG - Intronic
1131433238 15:92403084-92403106 ATGTGGTTACAGTAGGAAAGGGG - Intronic
1133895997 16:9929499-9929521 CTGTGGATTCAGAGAGAAGTGGG - Intronic
1133964810 16:10523000-10523022 CTGTGGGTAGACAGGGAACTGGG + Intergenic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1135188759 16:20337188-20337210 CTCTGGTAAAAGAGGGAAACAGG + Intronic
1138462338 16:57157885-57157907 TTGGGGTTACAGAGATAAATGGG - Intronic
1142270390 16:89086002-89086024 CTGTGGTCACCGGGGAAAATGGG + Intergenic
1144844230 17:18207809-18207831 TTGTGGTTTCAGGGGGTAATGGG + Intronic
1147620178 17:41861259-41861281 CTGTGGTTATAGAAAGGAATAGG - Intronic
1147814813 17:43201496-43201518 CTGTGGCTAAAGAGGAAAATGGG + Intronic
1148790708 17:50171079-50171101 CTGTTGTGACACAGGGGAATGGG + Intronic
1148846983 17:50535098-50535120 CTGTGGCTACTGGGGGGAATTGG + Intronic
1153348640 18:4055160-4055182 CTGTGGTCACTGAGGGACACAGG + Intronic
1153594790 18:6714413-6714435 CTGTGGTTTCACTGGGGAATGGG + Intergenic
1154134447 18:11763348-11763370 CTGTGGTTACAGAAGTGAAGTGG - Intronic
1156408909 18:36808957-36808979 ATGTAGTTACAGAGGCAAAGAGG + Intronic
1156410993 18:36828534-36828556 CCGTTGTTACAGAGGAAAGTGGG - Intronic
1157148560 18:45191230-45191252 CTGGGCTAACAGAGGGGAATTGG - Intergenic
1157446106 18:47748024-47748046 CTGTGGGTCCATAGGGAAATGGG - Intergenic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1158736706 18:60090761-60090783 CTGTGGTTGAACAGGGGAATGGG + Intergenic
1159382441 18:67678696-67678718 CTCTGGTTAAAGAGGTAGATTGG - Intergenic
1160307112 18:77750216-77750238 CAGTGGTTACAGCTGGAAAAAGG + Intergenic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1163890384 19:20007495-20007517 CTGTGGTTGAAGAGGAAGATGGG + Intronic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1168360141 19:55732619-55732641 CTTTGGCTGCAGAGGGAATTTGG - Exonic
925685890 2:6473092-6473114 CTGTGGTTACCGAGAGGATTAGG + Intergenic
926792727 2:16591556-16591578 CTGTGGTTACACAGCCAAATGGG + Intronic
927404900 2:22755687-22755709 CTGAGGATCCAGAGAGAAATGGG - Intergenic
929107793 2:38380948-38380970 TTGTAGGGACAGAGGGAAATCGG + Intergenic
929111466 2:38408560-38408582 CTGTGGCTAAAAGGGGAAATCGG + Intergenic
929241665 2:39659779-39659801 CAGTGGAAACAGAGAGAAATGGG - Intergenic
931020923 2:58044773-58044795 CTGTGGTTGAAGAGAGTAATAGG + Intronic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
931566111 2:63617530-63617552 CTGCGGTTACAGAAAGGAATAGG + Intronic
931789000 2:65646803-65646825 ATTTGGTTAGAGAGGGAAGTTGG - Intergenic
932035240 2:68238926-68238948 CTGTGGTTACAGAGTTGCATAGG - Intronic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
933862060 2:86479746-86479768 CGGTGATTTCAGAAGGAAATGGG - Intronic
934069947 2:88374563-88374585 CTGGGGCAAGAGAGGGAAATGGG + Intergenic
934697681 2:96411797-96411819 CTGAGGTTATAGAGGGACACAGG - Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935559677 2:104547343-104547365 CTGTGGTGACAAATGCAAATTGG - Intergenic
936149410 2:110006042-110006064 CTGTGGTTTGAGAGTGTAATTGG + Intergenic
936195269 2:110365328-110365350 CTGTGGTTTGAGAGTGTAATTGG - Intergenic
936725855 2:115314427-115314449 CTATTGTAACAGAGGGTAATTGG - Intronic
937018458 2:118628881-118628903 CTCTGCTTACAGGGGGACATTGG - Intergenic
938227668 2:129629958-129629980 ATGTGGATATAGAGAGAAATAGG - Intergenic
939027226 2:137028588-137028610 CTGGGGTTACAGGGATAAATTGG + Intronic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
940387518 2:153090791-153090813 CTGTGGCTACTGTGGGGAATGGG + Intergenic
942372096 2:175296038-175296060 CTGAGGCTGCAGAGGGAAAGGGG - Intergenic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
945212100 2:207394437-207394459 CTGAGGTTACAGAAGGAAGGAGG + Intergenic
945775702 2:214103830-214103852 TTGTGGGTACAGAAGGAAAGGGG + Intronic
946044353 2:216809450-216809472 CTGTGGAGTCAGAGTGAAATGGG + Intergenic
947004585 2:225496230-225496252 CTGAGGTTACAGAGGGAGTGAGG + Intronic
947106153 2:226669880-226669902 CTGGGGTTACAGTGGGACTTTGG + Intergenic
948513750 2:238489951-238489973 CTGAGGCTGCAGAGGGAAATAGG - Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169596817 20:7209885-7209907 CTGAGGTTAGAGAGGAAAAGAGG + Intergenic
1169985343 20:11437192-11437214 CTGTTCTTACAGTGGTAAATGGG - Intergenic
1174666424 20:52262122-52262144 CAGAATTTACAGAGGGAAATTGG - Intergenic
1175033622 20:55979032-55979054 CTGTGGTGGCAAAGGGAGATGGG - Intergenic
1175406636 20:58737265-58737287 CTATAGTTACAGAGAGAAAATGG + Intergenic
1175787928 20:61723761-61723783 GTGTGTTTACAGAGGGATCTGGG + Intronic
1177551935 21:22634448-22634470 CTGTGTTTTCACAGGGAAAAGGG + Intergenic
1177961906 21:27677935-27677957 AGGTGGTTACAAATGGAAATGGG + Intergenic
1178579836 21:33829132-33829154 CAGTGGTTTCTGAGGAAAATGGG + Intronic
1181207053 22:21260883-21260905 GTTTGGTTACAGAAGGAAACAGG + Intergenic
1181304034 22:21904243-21904265 CTTTGGTTACACAGCGAAGTCGG + Intergenic
1182198999 22:28550298-28550320 TTGTGCTTTCAAAGGGAAATGGG - Intronic
1182784123 22:32892396-32892418 CTGAGGATACAGAGGTTAATGGG + Intronic
1183192400 22:36330179-36330201 CTGTGTTGACAGTGGTAAATTGG - Intronic
1183738318 22:39656115-39656137 ATGTAATTACAGATGGAAATGGG + Intronic
1183759628 22:39804502-39804524 CTGAGGTTAAAGAGGGAAATGGG - Intronic
949612868 3:5720836-5720858 CTGTGCTTGCAGAGGTAAAATGG - Intergenic
949718404 3:6960495-6960517 TGGTGGTTACAGAGTAAAATGGG - Intronic
950329213 3:12143031-12143053 CTGTAGGTAGAGAGGGTAATGGG + Intronic
953059032 3:39411796-39411818 TTGTGGTTACATAAGCAAATTGG + Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954901765 3:54026141-54026163 ATGTGGTTACAAAGGGACCTTGG + Intergenic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
956012103 3:64842893-64842915 CTTTGGCTACAGTGGCAAATAGG - Intergenic
956061736 3:65355290-65355312 CTATGGTTTCAAAGTGAAATTGG + Intronic
956259503 3:67323066-67323088 CTGTCCTTACTGAGAGAAATAGG + Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
962893419 3:139692767-139692789 CTCTGGGTACAGATGGAAATAGG + Intergenic
964534203 3:157701676-157701698 CTGTGTTTACAAAGGTAATTAGG - Intergenic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
966571258 3:181446093-181446115 ATGTGGTTCCAGAAGGAAAGTGG + Intergenic
967341790 3:188406518-188406540 CTATGGTTACATAATGAAATAGG + Intronic
968052436 3:195664299-195664321 TTGTGGTGACAGCGGGGAATGGG + Intergenic
968103374 3:195984041-195984063 TTGTGGTGACAGCGGGGAATGGG - Intergenic
969692478 4:8711268-8711290 CGGTGGTTAGAGTGGGACATTGG - Intergenic
971527545 4:27639860-27639882 CTGTGGATACAGAGGGACAGAGG - Intergenic
972401274 4:38705982-38706004 ATGTGGTTACAGAAAGAAGTAGG - Intergenic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
976577424 4:86690194-86690216 CTCTAGTTAAAGAGGGAAAATGG - Intronic
976634334 4:87272754-87272776 CTGTGGATACAGTGGTAAATAGG + Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978896519 4:113895103-113895125 CAGTGGTTGCAGATGGAAGTTGG - Intergenic
979231653 4:118353648-118353670 CTCTGGTTAGAGAGGAAATTTGG - Intergenic
982690598 4:158543563-158543585 TTGTGTTAACAGAGGAAAATGGG + Intronic
983809872 4:172048462-172048484 CTGTGGTGACTGAGGGAAAATGG - Intronic
984133674 4:175909952-175909974 CTGTAGTGACAGTGGAAAATAGG - Intronic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
989723315 5:44554991-44555013 CTGTGAAAACAGAGGGAATTAGG + Intergenic
990432565 5:55750941-55750963 CTATGGTAACAGAGGGGAACAGG - Intronic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
991441055 5:66649776-66649798 CTGTGGATTCAGAGTGAAACAGG - Intronic
992335338 5:75761828-75761850 CTGTAGTTACAGAGGTAATAGGG - Intergenic
992810561 5:80383644-80383666 CTCAGGTCACAGAGAGAAATAGG - Intergenic
994833262 5:104813315-104813337 TTATGGTTACAGAGGTAAATAGG - Intergenic
994925213 5:106108537-106108559 GTGTGATTACAAAGGGCAATAGG - Intergenic
994975181 5:106794621-106794643 CTATGGCTTCAGAGGGATATGGG - Intergenic
995522156 5:113018990-113019012 GTGTGGTTCTAGAGTGAAATGGG + Exonic
995840658 5:116440479-116440501 ATGTGTTTGCAGAGGGGAATGGG + Intergenic
996117789 5:119636787-119636809 CTGTGGTAATAGAGGAAATTTGG - Intronic
996219391 5:120911099-120911121 CTGTGGTGAGAGAGGCAACTGGG - Intergenic
997517503 5:134501463-134501485 CTGTGGGGACAGAGGAAAAGAGG + Intergenic
999123904 5:149232002-149232024 CTTTGTTTAAAAAGGGAAATTGG + Intronic
999457813 5:151732498-151732520 CTGAGTTCACATAGGGAAATGGG - Intergenic
999572736 5:152938981-152939003 TTGTGGTTTCAGTGGGAAAGTGG - Intergenic
999691502 5:154149904-154149926 CTGTGGATACAGAGGGACAGAGG + Intronic
999916417 5:156267543-156267565 CTGTGCTCAGGGAGGGAAATTGG - Intronic
1000565470 5:162841417-162841439 CTGAGGTGACAGAGTGAAATTGG + Intergenic
1001003016 5:168025573-168025595 ATGTGGCTACATTGGGAAATAGG + Intronic
1001094817 5:168767991-168768013 ATGCAGATACAGAGGGAAATGGG - Intronic
1001322062 5:170690833-170690855 CTTGGGTTAAAGAGGGAGATTGG - Intronic
1002018781 5:176348149-176348171 CTGTGGTTTCAGAGGGAGAAGGG - Intronic
1007512053 6:42381259-42381281 TTGAGGTGACAGAGGGAAAGAGG - Intronic
1010564304 6:77390738-77390760 CTCTGCCTACAGAGGGCAATCGG + Intergenic
1011031555 6:82929793-82929815 GTGTGGATACAGAGGGAATATGG - Intronic
1011328063 6:86172848-86172870 ATGGGGTAACACAGGGAAATAGG + Intergenic
1011868852 6:91866958-91866980 CTTTGGTCAGTGAGGGAAATGGG + Intergenic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1015849790 6:137560136-137560158 CTGTGGTTGCTGTGGGGAATGGG + Intergenic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1016797028 6:148129297-148129319 CTGTTATTCCAGAGGAAAATAGG + Intergenic
1017550242 6:155498171-155498193 CAGTGGTTACAGAGGGAGTTTGG + Intergenic
1017702429 6:157088315-157088337 CTGTGGGAACAAAGAGAAATGGG - Intronic
1018248921 6:161848806-161848828 AAGATGTTACAGAGGGAAATGGG + Intronic
1021152384 7:17167386-17167408 TTGGGCTTACAGAGGGAATTTGG - Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022016395 7:26352557-26352579 CTGTGGTAGCAGGAGGAAATAGG - Intronic
1022411355 7:30141004-30141026 CTGTGGTCACACAGGGAACAAGG - Intronic
1022563672 7:31375221-31375243 CTGTGGGTACAGAGGTAAATGGG - Intergenic
1023798798 7:43815189-43815211 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1024860461 7:53834380-53834402 CTGTGGTCTCAGGTGGAAATGGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1025842403 7:65163084-65163106 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1025880642 7:65532885-65532907 CTGTGGCTACGTAGGGAGATGGG - Intergenic
1025892795 7:65669719-65669741 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1026479522 7:70765822-70765844 CAGTGGTGACAGCTGGAAATCGG + Intronic
1027784388 7:82562160-82562182 GTGTGGTTGCAGGTGGAAATAGG + Intergenic
1028960225 7:96740327-96740349 CTGGGGTGACAGAGGGAGTTAGG + Intergenic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1029861266 7:103574856-103574878 CTGAGATTAAAGAGGAAAATTGG - Intronic
1029913815 7:104184977-104184999 CTGAGGTTACAGAAAGAAAATGG - Intronic
1030791295 7:113732312-113732334 CTGTGGTATCAGAGTGAAGTGGG - Intergenic
1031372694 7:120987067-120987089 CAGTGGTTAAAATGGGAAATGGG + Intergenic
1031699970 7:124912737-124912759 CTGTGCTTCCTGAAGGAAATAGG - Intronic
1033113306 7:138602721-138602743 CTGTGGTTAGGGGTGGAAATGGG - Intronic
1035028994 7:155845085-155845107 CTGTGGTCACAGAGAGAGAGAGG + Intergenic
1036105017 8:5829424-5829446 CTTTAGGTGCAGAGGGAAATGGG + Intergenic
1037402366 8:18505890-18505912 CTTGGGTTACAGAGAGAAATGGG + Intergenic
1038378703 8:27070936-27070958 CTGAGGCTACAGAGGTAAAATGG + Intergenic
1038428169 8:27478824-27478846 CTGTGGTTACAGAAGAAAACAGG + Exonic
1039121142 8:34147754-34147776 CTGTGGTTTCTAAGAGAAATAGG - Intergenic
1039471160 8:37814581-37814603 CTGTGGTTCCAGAGTGGAAACGG + Intronic
1039781122 8:40786807-40786829 CTGTGCTTACAGAAGAAAATTGG + Intronic
1041698675 8:60763894-60763916 CTGTGGTCAGAGAGGAAAAGAGG + Intronic
1041751475 8:61265720-61265742 CTGTAGTAACAGAGGGTAAGTGG - Intronic
1045211504 8:100104799-100104821 CTGAGGTTACACAGACAAATAGG - Intronic
1046401118 8:113704410-113704432 CTTTTGTTACAGAAGGAAAATGG + Intergenic
1047215882 8:122875740-122875762 CCGTGGTTACACAGTGAGATGGG + Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048253276 8:132885051-132885073 GCCTGGTTACAGAAGGAAATTGG + Intronic
1048780665 8:137996329-137996351 CTGTGGTTGCAGAGTGCAGTTGG + Intergenic
1050313353 9:4375342-4375364 GTGTGGGTACAGAGAGAAAAGGG + Intergenic
1050699255 9:8319044-8319066 TAGGGGTTACAGAGGGAAATTGG - Intronic
1052418362 9:28207257-28207279 CTATGTTTACAGTGGGAAATTGG - Intronic
1052916204 9:33925950-33925972 CTGTGGGGACAGAGGGGAATAGG - Intronic
1053018157 9:34675837-34675859 CTGGGGTGTCAGAGGGAAGTAGG + Intergenic
1053196876 9:36126438-36126460 CTGTGGTTACACAGGGAGTCAGG + Intergenic
1053270466 9:36746050-36746072 CTCTGGATACAGAGGGACACCGG + Intergenic
1056843345 9:90016586-90016608 CTGGGGTTCCACATGGAAATGGG + Intergenic
1057214995 9:93223065-93223087 ATGAGGTTAAAGAGGGAACTTGG + Intronic
1058784576 9:108374610-108374632 CTGTGGCTACTGTGGGGAATAGG + Intergenic
1059529573 9:115023498-115023520 CTGAGGTCACAGAGTGAAGTTGG - Intronic
1060495237 9:124113473-124113495 CTGTGGCTGCAGAGGGAGCTAGG + Intergenic
1061279335 9:129588176-129588198 CTATGGTTAGATAGGGAGATGGG + Intergenic
1185952233 X:4450017-4450039 TTGAGGTTACAGAAGGAAAGGGG + Intergenic
1190945472 X:55089194-55089216 CTGTGGCTTCTGAGGGAAAAGGG + Intronic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1192895700 X:75440846-75440868 CTATGGTTGCTGTGGGAAATAGG + Intronic
1194424440 X:93719127-93719149 CAGTGGTTACAGAGGGGCAAGGG - Intergenic
1194795152 X:98202052-98202074 CTCTGGTTAAAGAAGGAATTGGG - Intergenic
1195331186 X:103802144-103802166 CTGAGGTGAGAGAGGAAAATAGG + Intergenic
1195644968 X:107220585-107220607 CAGTGGATGCAGAGGAAAATAGG + Intronic
1195823427 X:108971075-108971097 TAGTGGTTACAGAGGGCCATGGG + Intergenic
1198632457 X:138655859-138655881 CTATGGTTTCAGAGGGTAACTGG + Intronic
1199637451 X:149826864-149826886 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1199857136 X:151768664-151768686 CTTTTGTTAGACAGGGAAATCGG - Intergenic