ID: 986335063

View in Genome Browser
Species Human (GRCh38)
Location 5:6748537-6748559
Sequence CAGCCATGCTGTGTCACCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986335059_986335063 29 Left 986335059 5:6748485-6748507 CCTATGGCGCCATGCAGGTGAAG 0: 1
1: 0
2: 0
3: 7
4: 57
Right 986335063 5:6748537-6748559 CAGCCATGCTGTGTCACCGCTGG 0: 1
1: 0
2: 0
3: 13
4: 159
986335061_986335063 20 Left 986335061 5:6748494-6748516 CCATGCAGGTGAAGCAGGTCTTC 0: 1
1: 0
2: 2
3: 18
4: 202
Right 986335063 5:6748537-6748559 CAGCCATGCTGTGTCACCGCTGG 0: 1
1: 0
2: 0
3: 13
4: 159
986335062_986335063 -10 Left 986335062 5:6748524-6748546 CCTACATAGTGCTCAGCCATGCT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 986335063 5:6748537-6748559 CAGCCATGCTGTGTCACCGCTGG 0: 1
1: 0
2: 0
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986335063 Original CRISPR CAGCCATGCTGTGTCACCGC TGG Exonic