ID: 986336919

View in Genome Browser
Species Human (GRCh38)
Location 5:6762279-6762301
Sequence TACCAAAGTCTGTCACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986336909_986336919 24 Left 986336909 5:6762232-6762254 CCCTTGGGAACACTGGCCCCACC No data
Right 986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG No data
986336907_986336919 26 Left 986336907 5:6762230-6762252 CCCCCTTGGGAACACTGGCCCCA No data
Right 986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG No data
986336906_986336919 30 Left 986336906 5:6762226-6762248 CCTGCCCCCTTGGGAACACTGGC No data
Right 986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG No data
986336915_986336919 7 Left 986336915 5:6762249-6762271 CCCACCTGGGTGCTGGTTTCACC No data
Right 986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG No data
986336917_986336919 3 Left 986336917 5:6762253-6762275 CCTGGGTGCTGGTTTCACCACTT No data
Right 986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG No data
986336914_986336919 8 Left 986336914 5:6762248-6762270 CCCCACCTGGGTGCTGGTTTCAC No data
Right 986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG No data
986336908_986336919 25 Left 986336908 5:6762231-6762253 CCCCTTGGGAACACTGGCCCCAC No data
Right 986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG No data
986336916_986336919 6 Left 986336916 5:6762250-6762272 CCACCTGGGTGCTGGTTTCACCA No data
Right 986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG No data
986336910_986336919 23 Left 986336910 5:6762233-6762255 CCTTGGGAACACTGGCCCCACCT No data
Right 986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986336919 Original CRISPR TACCAAAGTCTGTCACAGAC AGG Intergenic
No off target data available for this crispr