ID: 986339526

View in Genome Browser
Species Human (GRCh38)
Location 5:6777305-6777327
Sequence CAGAGAAAGCAGAGGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986339526_986339530 -5 Left 986339526 5:6777305-6777327 CCTTCATCCCTCTGCTTTCTCTG No data
Right 986339530 5:6777323-6777345 CTCTGGTGCAGATGCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986339526 Original CRISPR CAGAGAAAGCAGAGGGATGA AGG (reversed) Intergenic
No off target data available for this crispr