ID: 986339766

View in Genome Browser
Species Human (GRCh38)
Location 5:6778989-6779011
Sequence TCCCATTCAAGGCCAGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986339766_986339771 12 Left 986339766 5:6778989-6779011 CCCGTGCCTGGCCTTGAATGGGA No data
Right 986339771 5:6779024-6779046 AGAGGCCTGAGAGAGACTCCTGG No data
986339766_986339770 -6 Left 986339766 5:6778989-6779011 CCCGTGCCTGGCCTTGAATGGGA No data
Right 986339770 5:6779006-6779028 ATGGGATTAGTGTTTTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986339766 Original CRISPR TCCCATTCAAGGCCAGGCAC GGG (reversed) Intergenic
No off target data available for this crispr