ID: 986339880

View in Genome Browser
Species Human (GRCh38)
Location 5:6779837-6779859
Sequence TTCCCACTAGAGCCCCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986339871_986339880 16 Left 986339871 5:6779798-6779820 CCAGCCATCACCAGAGCTGGAGG 0: 1
1: 0
2: 1
3: 30
4: 265
Right 986339880 5:6779837-6779859 TTCCCACTAGAGCCCCCAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 316
986339877_986339880 6 Left 986339877 5:6779808-6779830 CCAGAGCTGGAGGAGGGGCCTGG No data
Right 986339880 5:6779837-6779859 TTCCCACTAGAGCCCCCAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 316
986339869_986339880 26 Left 986339869 5:6779788-6779810 CCAAGTATTGCCAGCCATCACCA 0: 1
1: 2
2: 19
3: 103
4: 353
Right 986339880 5:6779837-6779859 TTCCCACTAGAGCCCCCAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 316
986339874_986339880 12 Left 986339874 5:6779802-6779824 CCATCACCAGAGCTGGAGGAGGG 0: 1
1: 1
2: 2
3: 33
4: 363
Right 986339880 5:6779837-6779859 TTCCCACTAGAGCCCCCAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986339880 Original CRISPR TTCCCACTAGAGCCCCCAAA AGG Intergenic
900889984 1:5442571-5442593 TCCCCACGAGAGCCTCCAGAAGG + Intergenic
901271411 1:7954524-7954546 TCCCCTCTGGAGCCCCCAAAAGG - Intronic
901501787 1:9657026-9657048 CTCCCCCTACAGCCCCCAGAGGG - Intronic
901622148 1:10597346-10597368 TTCCCACCAGGGCTCCGAAAGGG + Intronic
902098170 1:13963356-13963378 TGCCCACTACCGTCCCCAAATGG - Intergenic
905703033 1:40033163-40033185 TTTCCCCTAGAGCCTCCAGAAGG - Intergenic
906356582 1:45111584-45111606 TTTCCCCTAGAGCCTCCAGAAGG - Intronic
906571363 1:46844355-46844377 TACCCTTTTGAGCCCCCAAAGGG - Intergenic
906599909 1:47116887-47116909 TACCCTTTTGAGCCCCCAAAGGG + Intronic
906711670 1:47934812-47934834 TTCCCATCAGAGCCCCAACAGGG + Intronic
907697024 1:56741499-56741521 TACCCCCTAAAGGCCCCAAAAGG - Intronic
908480296 1:64533041-64533063 TTCCCAACAGAGCCCCAAAGAGG + Intronic
909600679 1:77458154-77458176 TTTCCCCTAGAGCCTCCAGAAGG - Intronic
910833350 1:91482541-91482563 TTCCCCCTAGAGTCTTCAAAGGG + Intergenic
911725576 1:101238166-101238188 TTATTAATAGAGCCCCCAAATGG + Intronic
913157398 1:116113448-116113470 TTCCACTTAGAGCCCTCAAAGGG - Intronic
913431878 1:118804208-118804230 TACACACTAGGGCCTCCAAAAGG + Intergenic
917386520 1:174482200-174482222 TTCCCCCCAGAGCCTCCAAAAGG + Intronic
917851606 1:179069281-179069303 TTCTCACTAGAGGGCGCAAAGGG - Intronic
922871503 1:228905663-228905685 TCTCCCCTAGAGCCTCCAAAAGG + Intergenic
1063163445 10:3438168-3438190 CTCCCCCTGGAGCCCCCAGAAGG - Intergenic
1066589729 10:36981435-36981457 TTCCCACTAGAGCCTTCAGAAGG + Intergenic
1066816531 10:39424367-39424389 TTTCCACGAGAGCCCACAAAGGG + Intergenic
1066820850 10:39487040-39487062 TTTCCACAATAGGCCCCAAATGG + Intergenic
1066823207 10:39523385-39523407 TTTCCACCATAGCCCTCAAAGGG - Intergenic
1069399969 10:68033805-68033827 TTCCCACTGCATTCCCCAAATGG + Intronic
1070499715 10:77060917-77060939 TCTCCTCTAGAGCCCCCAGAAGG + Intronic
1072031588 10:91527041-91527063 TCTCCCCTAGAGCCTCCAAAAGG - Intergenic
1072786295 10:98285345-98285367 TTCCCCCTAGAGCCTTCAGAGGG + Intergenic
1073355418 10:102849961-102849983 TCCCCAGTAGAGCCTCCAGATGG - Intergenic
1073484831 10:103810101-103810123 TCCTCACAAGAGCCTCCAAAAGG - Intronic
1073546475 10:104353713-104353735 TTCCCGCTAGCGCCCCTAGAGGG + Intergenic
1073598578 10:104824051-104824073 TTTCCCCTAGAGCCCCCACAAGG + Intronic
1074534562 10:114319605-114319627 TCCCCACTGGAGTCCCCAGATGG - Intronic
1075210285 10:120485234-120485256 TTCCCCCTAGAGCTCCCTGAAGG + Intronic
1076381440 10:130026986-130027008 TTCTCACTAGAGCTCCCCCAGGG - Intergenic
1078391031 11:10935521-10935543 TCTCCCCTAGAGCCCCCAGAAGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1082004315 11:47411315-47411337 TTCCCATAAGAGCCCATAAAAGG + Intronic
1082154868 11:48796307-48796329 TTCCCACCATAGGCCTCAAAGGG + Intergenic
1082319561 11:50784187-50784209 TTTCCACAAGAGGCCTCAAACGG + Intergenic
1082319588 11:50784700-50784722 TTCCCACAATAGGCCTCAAAGGG + Intergenic
1082604724 11:55211381-55211403 TTTTCACTATAGCCCTCAAATGG + Intergenic
1083225849 11:61284116-61284138 TTCCCGCTTTGGCCCCCAAAGGG - Intronic
1083287813 11:61671746-61671768 TTCCCCCTAGAGCCTCCAGAGGG - Intergenic
1085898341 11:80666585-80666607 TTCCCACTAGAGCCTTCAGAAGG - Intergenic
1087670104 11:101096451-101096473 TTCCAACTAGAGCCGACTAAGGG + Intronic
1089133680 11:116232478-116232500 TTCCCAGTGGAGCCCATAAAAGG + Intergenic
1089495758 11:118908003-118908025 TTCCCACCAGAGCTCCAGAAGGG - Intronic
1089884134 11:121803053-121803075 TTTCCGCTGGAGCCCACAAAAGG - Intergenic
1090956948 11:131521587-131521609 TTCCCACAAGAGTCCCCCTACGG - Intronic
1091314096 11:134598579-134598601 TCCCCACTATTGCCCTCAAATGG - Intergenic
1093478604 12:19582174-19582196 TGCCCAGCAGAGCCCCCAGAAGG - Intronic
1093684213 12:22038170-22038192 TTCCCCCTGGAGCCTCCAGAAGG - Intergenic
1095062203 12:37710943-37710965 TTCCCACCATAGGCCACAAACGG - Intergenic
1095062215 12:37711114-37711136 TTTCCACTATAGGCCCCAAAGGG - Intergenic
1095374783 12:41513638-41513660 TTCCCCCTAGAGCCAGCTAAAGG + Intronic
1095992119 12:48042357-48042379 TACCCACTAGAGCCACTTAAGGG + Intergenic
1098364412 12:69687386-69687408 TTCCCACCATAGCCTCCCAAAGG - Intronic
1099584370 12:84497997-84498019 TGCCCACTAGAGCCCCCTGTTGG + Intergenic
1099674979 12:85747479-85747501 TCCCCACTAGAGCTCACAAAAGG - Intergenic
1100353181 12:93804011-93804033 ATCCCCTTAGAGCCTCCAAAAGG + Intronic
1100751129 12:97699189-97699211 TCTCCCCTAGAGCCTCCAAAGGG - Intergenic
1101274970 12:103189617-103189639 TTCCCACTAGAGCTCCTAGGAGG - Intergenic
1101601477 12:106213781-106213803 TCTCCACTAGAGCCTCCAGAAGG + Intergenic
1101731085 12:107427135-107427157 TTTCCCCTGGAGCCTCCAAAAGG - Intronic
1102185810 12:110947788-110947810 TTCCTCCTAGAGCCTCCAGAAGG - Intergenic
1102386744 12:112516400-112516422 TCTCCCCTAGAGCCCCCAGAAGG - Intergenic
1102770718 12:115473581-115473603 TTCCACCAACAGCCCCCAAATGG + Intergenic
1103896298 12:124275512-124275534 TTCCCCCCAGAGCCTCCAGAAGG + Intronic
1104789683 12:131473665-131473687 TTCCCACTGAAGACCCCAAGGGG + Intergenic
1105075103 13:16006244-16006266 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1105088943 13:16251054-16251076 TTTCCACAATAGCCCTCAAAGGG - Intergenic
1109242422 13:59905847-59905869 TTTCCCCTAGAGCCCTCAGAAGG + Intronic
1109281949 13:60366987-60367009 TTCTCATTAGAGCCTCCAGAAGG - Intergenic
1110142162 13:72143833-72143855 TTCCCCCAGGAGCCTCCAAAGGG + Intergenic
1112433853 13:99376420-99376442 GCCCCACCAGAGCCCCCACAGGG - Intronic
1113999370 14:16137399-16137421 TTTCCACCATAGGCCCCAAAGGG + Intergenic
1117064359 14:51995272-51995294 TTCCCCCGAGAGCCTCCAAAAGG - Intronic
1118150378 14:63182664-63182686 TCTCCCCTAGAGCCTCCAAAAGG - Intergenic
1118381984 14:65224961-65224983 TTCCCACGGGAGGCCCCAGAGGG - Intergenic
1118486885 14:66222749-66222771 TTCCCCCTAGAGCCTCCTGAAGG - Intergenic
1118859324 14:69650204-69650226 CCCCCACTAGACTCCCCAAAGGG - Intronic
1120194148 14:81464676-81464698 TTTCCACTAGAGGGCACAAAAGG - Intergenic
1120761592 14:88290314-88290336 TTCTCCCTAAAGCCCCCAGAAGG + Intronic
1121337675 14:93087154-93087176 TTCTCCCTGGAGCCTCCAAAAGG - Intronic
1121731250 14:96188716-96188738 TTCCCCCTAGAGCCTTCACAGGG + Intergenic
1121901956 14:97701346-97701368 TACCCATAATAGCCCCCAAATGG + Intergenic
1122121933 14:99559215-99559237 TCCCCCCGAGAGCCTCCAAAAGG + Intronic
1122536308 14:102465973-102465995 TTCCCAACAGAGTCACCAAATGG - Intronic
1122785912 14:104163185-104163207 CTCCCACCTGTGCCCCCAAATGG + Intronic
1123226052 15:17031675-17031697 TTTCCACCAGAGGCCACAAAGGG - Intergenic
1123230416 15:17104098-17104120 TTCCCACCACAGTCCGCAAATGG - Intergenic
1123239302 15:17258430-17258452 TTCCCACCACAGTCCGCAAATGG - Intergenic
1123248226 15:17412971-17412993 TTCCCACCACAGTCCGCAAATGG - Intergenic
1123387294 15:19826337-19826359 TTTCCACCATAGACCCCAAAGGG + Intergenic
1124806053 15:32884264-32884286 TTCTCCCTAGAGCCTCTAAAAGG - Intronic
1124945062 15:34257776-34257798 TTCTTTCTAGACCCCCCAAATGG - Exonic
1128772857 15:70295362-70295384 TGCCCATTAGAGCCACCAAGAGG + Intergenic
1129457104 15:75681957-75681979 GTACCACTAGTGCCCCCACATGG + Intronic
1129511994 15:76131036-76131058 TTCCCATTATATCCCCCACAGGG + Intronic
1129726679 15:77904983-77905005 GTGCCACTAGTGCCCCCACATGG - Intergenic
1130990551 15:88873335-88873357 TACCCACAAGGGCCCCCAGATGG + Intronic
1133711786 16:8408623-8408645 TCCTCACTTGAGCCTCCAAATGG + Intergenic
1133782731 16:8952467-8952489 TTCCCCCTAGAACCTCCAGAAGG - Intronic
1133849297 16:9486703-9486725 TTCCTACTAGTGACACCAAAAGG + Intergenic
1136063499 16:27743007-27743029 CTCCCACTACACCCCCCAACAGG + Intronic
1136916522 16:34206583-34206605 TTTCCACCATAGCCCTCAAAGGG + Intergenic
1137077907 16:35998574-35998596 TTCCCACCATAGGCCGCAAAAGG - Intergenic
1137079671 16:36030925-36030947 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1137082523 16:36078798-36078820 TTTCCACTATAGGCCGCAAAGGG - Intergenic
1138211627 16:55167898-55167920 TACCCCCAAGAGCCTCCAAAGGG + Intergenic
1140904398 16:79398062-79398084 TCCCCACCAGAGCCTCCAGAAGG - Intergenic
1142947609 17:3445974-3445996 TTTACTCTAGAGCCTCCAAAAGG - Intronic
1143171774 17:4934455-4934477 CTGCCACTAGAGGCCCCACACGG - Exonic
1143348183 17:6265838-6265860 TTTCCCCTAGAGCCTCCAGAAGG - Intergenic
1143366428 17:6411604-6411626 TCCCCGCTAGAGCCTCCAGAAGG + Intronic
1143563021 17:7706174-7706196 TTGTCCCCAGAGCCCCCAAACGG - Intronic
1143889633 17:10092726-10092748 TTTCCCCTAGAGCCTCCAAGGGG - Intronic
1144125088 17:12195912-12195934 TTCCCAGTGAAGACCCCAAAGGG - Intergenic
1145365127 17:22256286-22256308 TTCTCACTAGAGGCCTCAATAGG + Intergenic
1145688836 17:26710809-26710831 TTTCCACCAGAGGCCGCAAAGGG - Intergenic
1145731557 17:27192052-27192074 TTCTCACTATAGGCCTCAAAGGG - Intergenic
1146299536 17:31677456-31677478 TTCCCCCCAGAGCCTCCAGAGGG - Intergenic
1146466307 17:33089402-33089424 TTTCCCCTAGAGCTGCCAAAAGG + Intronic
1148220122 17:45855266-45855288 TTCCCCCTAGAGCTTCCAGAGGG + Intergenic
1148514840 17:48206899-48206921 TTCCCACTTTAGCCTCCCAAGGG + Intronic
1149271462 17:54983068-54983090 TTCCCACAGGAGCCCCACAAGGG - Intronic
1149445370 17:56709043-56709065 TTTCCCCTAGAGCCTTCAAAAGG + Intergenic
1150604363 17:66678263-66678285 TTTCCTCTAGAGCCTCCAGAAGG + Intronic
1153824540 18:8863634-8863656 TTCCCACTACTGCCAGCAAAGGG + Intergenic
1154394345 18:13973267-13973289 TTCTCTCTAGAGCCCTCAGAAGG + Intergenic
1154535004 18:15395339-15395361 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1155334502 18:24750394-24750416 GTCCAACAAGAGCCCCCAGATGG + Intergenic
1156906760 18:42362111-42362133 TTGCCTCTAGAGCCTCCAGAAGG - Intergenic
1157167349 18:45370272-45370294 TTCCCCCAAGAGACCCCAGAAGG + Intronic
1161228610 19:3160730-3160752 TTTCCCTTAGAGCCTCCAAAAGG - Intronic
1163084107 19:14966869-14966891 TTGCCCCCACAGCCCCCAAAAGG - Intronic
1163644582 19:18481355-18481377 CCTCCCCTAGAGCCCCCAAAAGG - Intronic
1164334135 19:24293349-24293371 TTCTCACCATAGACCCCAAACGG - Intergenic
1164347907 19:27290049-27290071 TTTCCACTATAGGCCGCAAATGG - Intergenic
1164350501 19:27331591-27331613 TTTCCACCAGAGCCCTCAAAGGG + Intergenic
1164357559 19:27458295-27458317 TTTCCACTATAGGCCTCAAAGGG - Intergenic
1167064752 19:47176546-47176568 TGCCCACTGGAGTCCCCACAGGG + Intronic
1167800718 19:51739585-51739607 TTTCCTCCAGAGCCTCCAAAAGG + Intergenic
925965228 2:9059292-9059314 TTCCCATCTCAGCCCCCAAAGGG - Intergenic
927185450 2:20479018-20479040 TTCCCAATCCATCCCCCAAAGGG + Intergenic
927662567 2:25005297-25005319 TTATCATGAGAGCCCCCAAAAGG + Intergenic
930463604 2:51715416-51715438 TTCACATTACAGCCCCAAAATGG + Intergenic
930898848 2:56479697-56479719 TTCCTGCTAGAGCCTCCAAGGGG + Intergenic
933792988 2:85897951-85897973 TGCACACCAGAGCCCTCAAAGGG + Intergenic
934132424 2:88961522-88961544 TTCTCACTACTGCCCCCAGAAGG + Intergenic
934136876 2:89004424-89004446 TTCTCACTACTGCCCCCAGAAGG + Intergenic
934146081 2:89095249-89095271 TTCTCACTACTGCCCCCAGAAGG + Intergenic
934223179 2:90105326-90105348 TTCTCACTACTGCCCCCAGAAGG - Intergenic
934234233 2:90216065-90216087 TTCTCACTACTGCCCCCAGAAGG - Intergenic
934471995 2:94554614-94554636 TTTCCACCATAGGCCCCAAAGGG + Intergenic
935012112 2:99145093-99145115 TTTCCCCTAGAGCCTCCAGAAGG - Intronic
936491997 2:112979874-112979896 TCCCAACTAGACCCACCAAATGG - Intronic
936956410 2:118026910-118026932 CTCCCACCTGAGCCTCCAAAAGG - Intergenic
938395645 2:130945718-130945740 TTCCCTCTAGAGTCCTCAAACGG + Intronic
938533096 2:132210849-132210871 TTTCCACCATAGGCCCCAAAGGG - Intronic
939581756 2:143958147-143958169 AGCCAATTAGAGCCCCCAAAAGG - Intronic
942456436 2:176141284-176141306 TGCCCAGTGGAGCCCACAAAAGG - Intergenic
943779758 2:191810276-191810298 TTCCCCCTAGAGACTCTAAAAGG - Intergenic
944863683 2:203839908-203839930 TCTCCCCTAGAGTCCCCAAATGG - Intergenic
945897611 2:215502330-215502352 TTCTCCCTAGAGCCTCCAGAAGG - Intergenic
947621751 2:231595233-231595255 TTCCCAGCAGAGTCTCCAAATGG + Intergenic
948516261 2:238505583-238505605 TTCCCCTTAGAGCCCCCGGAAGG - Intergenic
1168758248 20:330630-330652 CTCCCAGTACAGCCCACAAAGGG - Intergenic
1169450279 20:5705088-5705110 TTTCCACTAGAGCCTCCAGTAGG - Intergenic
1169507140 20:6223407-6223429 TTCCCCCTAAAGCCCCAAAAAGG - Intergenic
1169901953 20:10562316-10562338 TTCCCACTAGATCCCCCTTCTGG - Intronic
1170063438 20:12285011-12285033 TTTCCTCTAGAGCCTCCAAAAGG - Intergenic
1171735265 20:28773921-28773943 TTTCCACCAGAGGCCACAAAGGG + Intergenic
1171744564 20:28955697-28955719 TTCCCACGATAGGCCTCAAAGGG - Intergenic
1171762041 20:29212841-29212863 TTTCCACCATAGCCCTCAAAGGG - Intergenic
1171765151 20:29260252-29260274 TTTCCACCAGAGGCCGCAAAGGG - Intergenic
1171821205 20:29842771-29842793 TTTCCACAAGAGGCCTCAAAGGG - Intergenic
1171821735 20:29852827-29852849 TTTCCACAGTAGCCCCCAAAGGG - Intergenic
1171825192 20:29893272-29893294 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1172170655 20:32929841-32929863 TTCCCACTGTGGCCCCCACATGG + Intronic
1173793667 20:45843942-45843964 CTCCCACTCTAGGCCCCAAAAGG + Intronic
1174632067 20:51966806-51966828 TTCCCACTCCCACCCCCAAACGG + Intergenic
1174661315 20:52215481-52215503 TTCCCCCCAGAGCCTCCAGAAGG + Intergenic
1175055404 20:56193118-56193140 TTCCCACTGGAGCCTCCAGAAGG - Intergenic
1175239037 20:57533254-57533276 TTTCCCCTAGAGCCTCCAAAAGG + Intergenic
1176535827 21:8049626-8049648 TTTCCACCATAGGCCCCAAAGGG + Intergenic
1176653918 21:9573079-9573101 TGCCCACTTGAGCCCACAAAGGG - Intergenic
1176904977 21:14489500-14489522 TTTTCAATAAAGCCCCCAAATGG + Intronic
1177773856 21:25546434-25546456 TCTCCACTAGAGCCTCCAGAAGG - Intergenic
1178517266 21:33258449-33258471 TTTCCCCTAGAGCCTCCATAAGG + Intronic
1178719022 21:34991985-34992007 TTCCCCCTAGAGCCTGCACAGGG + Intronic
1179987528 21:44929983-44930005 TTCCCACCAGAAACCCCAAGTGG + Intronic
1180070563 21:45433984-45434006 TTGGCACCTGAGCCCCCAAAGGG - Intronic
1180131151 21:45828124-45828146 TTCCCACAAGAGACGCCAACTGG + Intronic
1180324985 22:11362604-11362626 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1180325364 22:11369936-11369958 TTTCCACAATAGCCCTCAAAGGG - Intergenic
1180396153 22:12342667-12342689 TTTCCACTATAGGCCACAAAGGG + Intergenic
1180400058 22:12408341-12408363 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1180403586 22:12521926-12521948 TTTCCACTATAGGCCACAAAGGG - Intergenic
1180509759 22:16068989-16069011 TTTCCACCATAGGCCCCAAAGGG + Intergenic
1183421452 22:37713940-37713962 GTCCCAGGAGACCCCCCAAAAGG + Intronic
1184392184 22:44210175-44210197 TTCCCTCTAGAACCTCCAGAGGG - Intronic
951164954 3:19474250-19474272 TTCCCACAAAATTCCCCAAAAGG + Intronic
952966644 3:38625183-38625205 TCTCCCCTAGAGCCTCCAAAAGG + Intronic
953766361 3:45746652-45746674 TTCCCACTCCAGGCCCCCAAAGG - Intergenic
953852284 3:46473577-46473599 TTCCCCCTGGAGCCTCCAGAGGG - Intronic
955229979 3:57090152-57090174 ATCCCACTAGATCCCACAAAGGG + Exonic
956512768 3:70012527-70012549 TTTCCACTAGAGCCTCCAGAAGG + Intergenic
956715549 3:72076651-72076673 TTTCCCCTAGAGCCTCCAAAAGG - Intergenic
956746381 3:72314246-72314268 TTTCCAGAAAAGCCCCCAAATGG - Intergenic
957164033 3:76647352-76647374 CTCCCACTAGTGCCCCCTATCGG + Intronic
958220587 3:90669979-90670001 TTTCCACTATAGGCCTCAAATGG + Intergenic
958226024 3:90821166-90821188 TTTCCACCATAGGCCCCAAACGG - Intergenic
958246738 3:91169478-91169500 TTTCCACCATAGGCCCCAAACGG - Intergenic
958252015 3:91278175-91278197 TTTCCACCATAGGCCCCAAACGG + Intergenic
958408497 3:93781306-93781328 TTTCCACCAGAGGCCTCAAAGGG + Intergenic
959487192 3:106940500-106940522 TCTCCTCCAGAGCCCCCAAAAGG - Intergenic
960301120 3:116003826-116003848 TTCCCACTAGATCCTTCAAAGGG + Intronic
963885428 3:150576643-150576665 TTCACACAAGTGCCACCAAAAGG - Intronic
967882860 3:194314121-194314143 ATCCCACTAGAGACCCCAGCAGG + Intergenic
969461200 4:7330014-7330036 TTTCCCCTAGAGCCTCCAGAAGG - Intronic
969741378 4:9030019-9030041 TTCCCACCACAGCCTCCCAAAGG - Intergenic
969847864 4:9933771-9933793 TTCTCCCTAGAGCCTCCAGAAGG - Intronic
970641883 4:18075964-18075986 CTCCCTCTAGTGCCCCCTAATGG - Intergenic
970935174 4:21561227-21561249 TTCCCACTAATACCCCCAAAAGG - Intronic
971702280 4:29994006-29994028 TTTCCTCTAGAGCCTCCAAAAGG - Intergenic
971941945 4:33226925-33226947 TTCCCACTAGGTCCCCTACATGG - Intergenic
972576905 4:40360182-40360204 TGTCCCCTAGAGCCTCCAAAAGG + Intergenic
973176406 4:47211746-47211768 CTCCCACTAGAGCTTCCAGAAGG - Intronic
973530284 4:51831014-51831036 TTTCCCCTAGAGCCTCCAGAAGG - Intergenic
975634674 4:76435791-76435813 TTCTCACTGAAGCCCCCAAGTGG - Exonic
978644937 4:110918990-110919012 TTTCCCCTAGAGCCTCCAGAAGG - Intergenic
980249007 4:130289611-130289633 TTGCAATAAGAGCCCCCAAATGG + Intergenic
981432829 4:144681799-144681821 TTCCCAATTCTGCCCCCAAAAGG - Intronic
984559743 4:181254363-181254385 TTCTCACAATAGCCCTCAAATGG + Intergenic
985781430 5:1873846-1873868 TTCCCATCGGAGCCACCAAACGG - Intergenic
986339880 5:6779837-6779859 TTCCCACTAGAGCCCCCAAAAGG + Intergenic
987635893 5:20540917-20540939 TGCCCACTAGAGCCTCCTTAGGG + Intronic
988484424 5:31656800-31656822 TTCCTCTTAGAGCCCCTAAAAGG - Intronic
989943926 5:50193149-50193171 TTCCCACCATAGCCCTTAAAGGG + Intergenic
989944802 5:50209476-50209498 TTTCCACTATAGACCTCAAAGGG + Intergenic
990118806 5:52423779-52423801 TTTCCCCATGAGCCCCCAAAAGG + Intergenic
990279348 5:54232756-54232778 TTCCCACAAGAGCCATCAATTGG + Intronic
990592605 5:57281591-57281613 TTTCCCCTAGAGCCTCCAGAAGG + Intergenic
997192225 5:131947830-131947852 TTTTCACAACAGCCCCCAAAGGG - Intronic
999723618 5:154417173-154417195 ATCCCACAAGAGGCCCCACAGGG + Exonic
999782269 5:154858825-154858847 TTCCCCCTACAGACCCCCAATGG - Intronic
1003384591 6:5655512-5655534 TTTCCCCTAGAGCCTCCAGAAGG - Intronic
1004199166 6:13532064-13532086 TTGCCTCTAGAGCCTCCAGAAGG - Intergenic
1005121919 6:22399767-22399789 TTCTCACTGGGGCACCCAAAGGG + Intergenic
1005164007 6:22898058-22898080 TTCCCTCTGGAGCCTCCAGAAGG + Intergenic
1012433359 6:99189249-99189271 TTTCCCCTAGAGCCTCCAGAAGG - Intergenic
1016145649 6:140669393-140669415 TTTCCCCTAGAGCCTCCAGAAGG - Intergenic
1017441357 6:154467074-154467096 TTCCAGTTAGAGCCCTCAAATGG + Intronic
1019841819 7:3453631-3453653 TTCCCCTTAGAGCCTCCAGAGGG + Intronic
1023391498 7:39715473-39715495 TCCCCACTAGAGCCTCCAGAAGG + Intergenic
1023658555 7:42450503-42450525 TCTCCCCTAGAGCCTCCAAAAGG + Intergenic
1023754203 7:43400855-43400877 TTTGCACCAGAGCCCCCAGAAGG - Intronic
1023843550 7:44109278-44109300 TTGTCCCTAGAGCCCCGAAAGGG + Exonic
1024256794 7:47545578-47545600 TTCCCATGGGAGCCCCCCAAGGG - Intronic
1024997209 7:55280804-55280826 TTCCCACCTCAGCCCCCAAGTGG - Intergenic
1025309275 7:57908497-57908519 TTTCCACAAGAGTCCTCAAAGGG + Intergenic
1025314123 7:57996273-57996295 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1025500811 7:61293198-61293220 TTTCCACCAGAGGCCTCAAAGGG - Intergenic
1025515672 7:61639421-61639443 TTTCCACCAGAGGCCTCAAAGGG - Intergenic
1025540008 7:62068247-62068269 TTTCCACCAGAGGCCTCAAAGGG - Intergenic
1025909849 7:65819598-65819620 TTCTCTCTAGAGCCTCCAAAAGG + Intergenic
1025996734 7:66531919-66531941 TTTCCCCTAGAGCCTCCAGAAGG - Intergenic
1026044133 7:66894072-66894094 TTCTCTCTAGAGCCTCCAGAAGG + Intergenic
1026654876 7:72248086-72248108 TATCCACTAGAGCCTCCAGAAGG - Intronic
1026989628 7:74576580-74576602 TTTCCCCTAGAGCCTCCAGAAGG - Intronic
1027338870 7:77184067-77184089 TTGCCAGCTGAGCCCCCAAAGGG + Intronic
1030557549 7:111045737-111045759 TCTCCCCTAGAGCCTCCAAAAGG + Intronic
1031094834 7:117405145-117405167 TTCCCACTAGAGCTCTCCATGGG + Intronic
1031407564 7:121405020-121405042 TTCTCCCTAGAGCCTCCAAAGGG - Intergenic
1032149404 7:129415236-129415258 TTGCTTCTAGAGCCCCCAAAGGG + Intronic
1032738347 7:134713345-134713367 TTCCAACTAGATCCCTTAAAAGG - Intergenic
1034804915 7:154080872-154080894 TTCCCATTAGAGCCCTCATGAGG - Intronic
1036195648 8:6711716-6711738 TTCCCCCTAGGGCCTCCAGAGGG - Intronic
1036652939 8:10657129-10657151 TTCCCCCTACACTCCCCAAAAGG + Intronic
1036825555 8:11973070-11973092 ATCCAACTAGACCCCCCGAATGG - Intergenic
1038010349 8:23470995-23471017 TTCCCGCTACAGCCTCCAGAAGG - Intergenic
1038232699 8:25718321-25718343 TTCCCACTTCAGCTCCCAGATGG + Intergenic
1038403957 8:27308117-27308139 TTCTCCCTGGAGCCTCCAAAAGG + Intronic
1043516728 8:81001557-81001579 TTCCCTCCAGGGCCCCCAAGAGG + Intronic
1043558815 8:81466644-81466666 TTCCCACTCTAGCCATCAAAGGG - Intergenic
1044250070 8:89996048-89996070 TTGTAACAAGAGCCCCCAAAAGG + Intronic
1045658775 8:104414242-104414264 GTCCAATTAGCGCCCCCAAATGG - Intronic
1047349043 8:124055831-124055853 TTCCCCCTAGAGCCTCCAGAAGG - Intronic
1047688745 8:127329368-127329390 TTCTCCCTAGAGCCTCCAAAAGG + Intergenic
1048441640 8:134463477-134463499 TTTCCACCAGAGCCTCCAGAAGG + Intergenic
1051599572 9:18859222-18859244 TTCCCCGTAGAGCCTCCAGAAGG - Intronic
1053686684 9:40535285-40535307 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1053938354 9:43195688-43195710 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1054277117 9:63090790-63090812 TTTCCACCATAGGCCCCAAAGGG + Intergenic
1054397720 9:64674139-64674161 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1054432360 9:65179333-65179355 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1054498024 9:65842343-65842365 TTTCCACCATAGGCCCCAAAGGG + Intergenic
1055503395 9:76924235-76924257 TCTCCCCTAGAGCCTCCAAAAGG + Intergenic
1055811936 9:80159048-80159070 TTCCCCCTAAAGCTCCCCAAAGG - Intergenic
1055831944 9:80390221-80390243 TTTCCTCTAGAACCTCCAAAAGG - Intergenic
1058944944 9:109847362-109847384 TGTCCCCTAGAGCCTCCAAAGGG + Intronic
1059261909 9:112985197-112985219 TTTCCCCTACAGCCTCCAAAGGG + Intergenic
1059545329 9:115170074-115170096 TCTCCTCTAGAGCCTCCAAAAGG - Intronic
1059948480 9:119437646-119437668 TTTCCCCTAGAGCCTCCAGAAGG - Intergenic
1060089412 9:120730000-120730022 GTCCCACCAGCGCCCCCAACAGG - Intergenic
1060488162 9:124062629-124062651 TTCCCTCCTCAGCCCCCAAAAGG - Intergenic
1062405628 9:136394941-136394963 ATCCCTCCAGAGCCCACAAAAGG + Intronic
1203384458 Un_KI270438v1:10408-10430 TTTCCACCATAGGCCCCAAATGG - Intergenic
1203384492 Un_KI270438v1:11092-11114 TTCCCACTATAGGCCGCAAAGGG - Intergenic
1203372631 Un_KI270442v1:323176-323198 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1203372656 Un_KI270442v1:323516-323538 TTTCCACCATAGGCCCCAAAGGG - Intergenic
1203375167 Un_KI270442v1:366613-366635 TTTCCACTATAGGCCACAAAGGG - Intergenic
1203414838 Un_KI270590v1:2351-2373 TTTCCACAAAAGGCCCCAAAGGG + Intergenic
1203631638 Un_KI270750v1:76531-76553 TGCCCACTTGAGCCCACAAAGGG - Intergenic
1203685999 Un_KI270757v1:60516-60538 TTCCCACCACAGGCCACAAAGGG + Intergenic
1203686333 Un_KI270757v1:66013-66035 TTTCCACTATAGGCCACAAAGGG + Intergenic
1185826767 X:3258754-3258776 TCTCCCCTAGAGCCTCCAAAGGG - Intergenic
1186117715 X:6322356-6322378 TCTCCCCTAGAGCCTCCAAAAGG + Intergenic
1187333886 X:18365026-18365048 TCTCCCCTAGAGCCTCCAAAAGG - Intergenic
1187561629 X:20408765-20408787 TCTCCCCTAGAGCCTCCAAAGGG - Intergenic
1189577404 X:42369072-42369094 TCTCCCCTAGAGCCTCCAAAGGG + Intergenic
1189627792 X:42918003-42918025 TTTCCCCTAGAGACTCCAAAGGG + Intergenic
1190118621 X:47642181-47642203 TTTCCCCTAGAGCCTCCAGAAGG + Intronic
1191272159 X:58488116-58488138 TTTCCACCAGAACCCTCAAACGG - Intergenic
1191570655 X:62613006-62613028 TTCCCATCATAGCCCTCAAAGGG - Intergenic
1191705753 X:64092985-64093007 TCCCCAATAGATCCCCAAAATGG - Intergenic
1193213027 X:78829738-78829760 TCCCCCTTAGAGCACCCAAAAGG + Intergenic
1194845973 X:98809559-98809581 TTCCCACTGCAGTCACCAAATGG - Intergenic
1195664573 X:107417125-107417147 TTTCCCCTAGAGCCCCTAGAGGG + Intergenic
1196030702 X:111092926-111092948 TACCCACTTGTGCTCCCAAAAGG + Intronic
1196941162 X:120777364-120777386 TTCCCATTAGAGTCAGCAAATGG - Intergenic
1197253556 X:124239334-124239356 TCCCCTCTAGAGCCTCCAGAAGG - Intronic
1197867358 X:131033558-131033580 TCTCCCCTAGAGCCTCCAAAGGG - Intergenic
1199297405 X:146174683-146174705 TTTCCCCTAGAGCCTCCAGAAGG - Intergenic
1199510028 X:148611513-148611535 TTTCCCCTAGAGCCTCCAGAAGG - Intronic
1199675673 X:150187241-150187263 TTCCCCCTAGAGCCTCTAGAAGG - Intergenic
1200327076 X:155251955-155251977 TTCTGCCTAGAGCACCCAAAAGG + Intergenic
1200926195 Y:8657105-8657127 TTCCCATTAAAGCCACCAACAGG + Intergenic
1200931924 Y:8704639-8704661 TTCCCATTACAGCCACCAAAAGG - Intergenic
1200932484 Y:8709620-8709642 TTCCCTTTAGAGCCACCAAAAGG - Intergenic
1201079636 Y:10226132-10226154 TTTCCACTATAGGCCACAAATGG + Intergenic
1201090635 Y:10469424-10469446 TTCCCACCATAGGCCACAAAAGG - Intergenic
1201095368 Y:10604284-10604306 TTCCCACCATAGGCCACAAAAGG + Intergenic
1201538184 Y:15074879-15074901 TCTCCACTGGAGCCTCCAAAGGG + Intergenic
1201565445 Y:15360683-15360705 CTCCCACTTGTGCCCCCAAGTGG - Intergenic
1201903881 Y:19069763-19069785 TCCCCACTGGAGCCTCCAGAAGG + Intergenic
1202130392 Y:21603818-21603840 TTCCCATTACAGCCACCAACAGG - Intergenic