ID: 986342806

View in Genome Browser
Species Human (GRCh38)
Location 5:6805599-6805621
Sequence GACTGCCAGCAAGTTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986342806_986342810 2 Left 986342806 5:6805599-6805621 CCCATGGAAACTTGCTGGCAGTC No data
Right 986342810 5:6805624-6805646 AGCCTCTTAGAGTGATCCCCTGG No data
986342806_986342817 26 Left 986342806 5:6805599-6805621 CCCATGGAAACTTGCTGGCAGTC No data
Right 986342817 5:6805648-6805670 AGCCTCCCAGACTTTTTAAAGGG No data
986342806_986342816 25 Left 986342806 5:6805599-6805621 CCCATGGAAACTTGCTGGCAGTC No data
Right 986342816 5:6805647-6805669 GAGCCTCCCAGACTTTTTAAAGG No data
986342806_986342811 3 Left 986342806 5:6805599-6805621 CCCATGGAAACTTGCTGGCAGTC No data
Right 986342811 5:6805625-6805647 GCCTCTTAGAGTGATCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986342806 Original CRISPR GACTGCCAGCAAGTTTCCAT GGG (reversed) Intergenic
No off target data available for this crispr