ID: 986345352

View in Genome Browser
Species Human (GRCh38)
Location 5:6829894-6829916
Sequence CCTGAAAAGCAGAATGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986345352_986345357 21 Left 986345352 5:6829894-6829916 CCATCTCCATTCTGCTTTTCAGG No data
Right 986345357 5:6829938-6829960 ACAATGAAACAATGTTCAGGTGG No data
986345352_986345356 18 Left 986345352 5:6829894-6829916 CCATCTCCATTCTGCTTTTCAGG No data
Right 986345356 5:6829935-6829957 ACTACAATGAAACAATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986345352 Original CRISPR CCTGAAAAGCAGAATGGAGA TGG (reversed) Intergenic
No off target data available for this crispr