ID: 986350178

View in Genome Browser
Species Human (GRCh38)
Location 5:6870326-6870348
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986350176_986350178 18 Left 986350176 5:6870285-6870307 CCACTCAACTCTAATCTCATTTT No data
Right 986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type