ID: 986351652

View in Genome Browser
Species Human (GRCh38)
Location 5:6885673-6885695
Sequence GTCAATCAAGTGCCCCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986351652_986351656 0 Left 986351652 5:6885673-6885695 CCTGATGGGGGCACTTGATTGAC No data
Right 986351656 5:6885696-6885718 TTATTCAGGAAACAGGAAGGAGG No data
986351652_986351654 -7 Left 986351652 5:6885673-6885695 CCTGATGGGGGCACTTGATTGAC No data
Right 986351654 5:6885689-6885711 GATTGACTTATTCAGGAAACAGG No data
986351652_986351657 9 Left 986351652 5:6885673-6885695 CCTGATGGGGGCACTTGATTGAC No data
Right 986351657 5:6885705-6885727 AAACAGGAAGGAGGCCAGTGTGG 0: 3
1: 14
2: 86
3: 359
4: 1248
986351652_986351655 -3 Left 986351652 5:6885673-6885695 CCTGATGGGGGCACTTGATTGAC No data
Right 986351655 5:6885693-6885715 GACTTATTCAGGAAACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986351652 Original CRISPR GTCAATCAAGTGCCCCCATC AGG (reversed) Intergenic
No off target data available for this crispr