ID: 986353441

View in Genome Browser
Species Human (GRCh38)
Location 5:6902225-6902247
Sequence GTGGACACAGATTGTCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986353434_986353441 10 Left 986353434 5:6902192-6902214 CCTGGATGGGAAAGGAGAAGAGT No data
Right 986353441 5:6902225-6902247 GTGGACACAGATTGTCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986353441 Original CRISPR GTGGACACAGATTGTCACCT GGG Intergenic
No off target data available for this crispr