ID: 986355085

View in Genome Browser
Species Human (GRCh38)
Location 5:6915978-6916000
Sequence CAGATTTCCCACTATGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986355082_986355085 -4 Left 986355082 5:6915959-6915981 CCATCTACTTCCAGGAAGGCAGA No data
Right 986355085 5:6915978-6916000 CAGATTTCCCACTATGATGGTGG No data
986355078_986355085 17 Left 986355078 5:6915938-6915960 CCCAAGGAGCTGCGTGAGTTTCC No data
Right 986355085 5:6915978-6916000 CAGATTTCCCACTATGATGGTGG No data
986355079_986355085 16 Left 986355079 5:6915939-6915961 CCAAGGAGCTGCGTGAGTTTCCA No data
Right 986355085 5:6915978-6916000 CAGATTTCCCACTATGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986355085 Original CRISPR CAGATTTCCCACTATGATGG TGG Intergenic
No off target data available for this crispr