ID: 986358458

View in Genome Browser
Species Human (GRCh38)
Location 5:6951964-6951986
Sequence GAGGGCAAGCAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2999
Summary {0: 67, 1: 274, 2: 555, 3: 796, 4: 1307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986358445_986358458 24 Left 986358445 5:6951917-6951939 CCCTGTTTGTCACATTGGGACTG No data
Right 986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG 0: 67
1: 274
2: 555
3: 796
4: 1307
986358446_986358458 23 Left 986358446 5:6951918-6951940 CCTGTTTGTCACATTGGGACTGG No data
Right 986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG 0: 67
1: 274
2: 555
3: 796
4: 1307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986358458 Original CRISPR GAGGGCAAGCAGAAGCAGGG TGG Intergenic
Too many off-targets to display for this crispr