ID: 986361778

View in Genome Browser
Species Human (GRCh38)
Location 5:6985347-6985369
Sequence TACCAAATGCTGCTGAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986361778_986361781 18 Left 986361778 5:6985347-6985369 CCATTCCTCAGCAGCATTTGGTA No data
Right 986361781 5:6985388-6985410 CTTAACACCCTTGTTTCATGTGG No data
986361778_986361784 27 Left 986361778 5:6985347-6985369 CCATTCCTCAGCAGCATTTGGTA No data
Right 986361784 5:6985397-6985419 CTTGTTTCATGTGGCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986361778 Original CRISPR TACCAAATGCTGCTGAGGAA TGG (reversed) Intergenic
No off target data available for this crispr