ID: 986364502

View in Genome Browser
Species Human (GRCh38)
Location 5:7017135-7017157
Sequence TGGTCCCTTAGGTCCTGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986364502_986364510 23 Left 986364502 5:7017135-7017157 CCTAGCCAGGACCTAAGGGACCA No data
Right 986364510 5:7017181-7017203 ATCTGGCTGTGTTGTCACATTGG No data
986364502_986364512 30 Left 986364502 5:7017135-7017157 CCTAGCCAGGACCTAAGGGACCA No data
Right 986364512 5:7017188-7017210 TGTGTTGTCACATTGGACCTGGG No data
986364502_986364511 29 Left 986364502 5:7017135-7017157 CCTAGCCAGGACCTAAGGGACCA No data
Right 986364511 5:7017187-7017209 CTGTGTTGTCACATTGGACCTGG No data
986364502_986364507 6 Left 986364502 5:7017135-7017157 CCTAGCCAGGACCTAAGGGACCA No data
Right 986364507 5:7017164-7017186 GCAGCGAGCTGCCAGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986364502 Original CRISPR TGGTCCCTTAGGTCCTGGCT AGG (reversed) Intergenic
No off target data available for this crispr