ID: 986364503

View in Genome Browser
Species Human (GRCh38)
Location 5:7017140-7017162
Sequence CGAGGTGGTCCCTTAGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986364503_986364510 18 Left 986364503 5:7017140-7017162 CCAGGACCTAAGGGACCACCTCG No data
Right 986364510 5:7017181-7017203 ATCTGGCTGTGTTGTCACATTGG No data
986364503_986364512 25 Left 986364503 5:7017140-7017162 CCAGGACCTAAGGGACCACCTCG No data
Right 986364512 5:7017188-7017210 TGTGTTGTCACATTGGACCTGGG No data
986364503_986364511 24 Left 986364503 5:7017140-7017162 CCAGGACCTAAGGGACCACCTCG No data
Right 986364511 5:7017187-7017209 CTGTGTTGTCACATTGGACCTGG No data
986364503_986364507 1 Left 986364503 5:7017140-7017162 CCAGGACCTAAGGGACCACCTCG No data
Right 986364507 5:7017164-7017186 GCAGCGAGCTGCCAGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986364503 Original CRISPR CGAGGTGGTCCCTTAGGTCC TGG (reversed) Intergenic
No off target data available for this crispr