ID: 986364504

View in Genome Browser
Species Human (GRCh38)
Location 5:7017146-7017168
Sequence GCTGCACGAGGTGGTCCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986364504_986364507 -5 Left 986364504 5:7017146-7017168 CCTAAGGGACCACCTCGTGCAGC No data
Right 986364507 5:7017164-7017186 GCAGCGAGCTGCCAGCCATCTGG No data
986364504_986364512 19 Left 986364504 5:7017146-7017168 CCTAAGGGACCACCTCGTGCAGC No data
Right 986364512 5:7017188-7017210 TGTGTTGTCACATTGGACCTGGG No data
986364504_986364515 30 Left 986364504 5:7017146-7017168 CCTAAGGGACCACCTCGTGCAGC No data
Right 986364515 5:7017199-7017221 ATTGGACCTGGGCCACTGGAGGG No data
986364504_986364511 18 Left 986364504 5:7017146-7017168 CCTAAGGGACCACCTCGTGCAGC No data
Right 986364511 5:7017187-7017209 CTGTGTTGTCACATTGGACCTGG No data
986364504_986364513 26 Left 986364504 5:7017146-7017168 CCTAAGGGACCACCTCGTGCAGC No data
Right 986364513 5:7017195-7017217 TCACATTGGACCTGGGCCACTGG No data
986364504_986364510 12 Left 986364504 5:7017146-7017168 CCTAAGGGACCACCTCGTGCAGC No data
Right 986364510 5:7017181-7017203 ATCTGGCTGTGTTGTCACATTGG No data
986364504_986364514 29 Left 986364504 5:7017146-7017168 CCTAAGGGACCACCTCGTGCAGC No data
Right 986364514 5:7017198-7017220 CATTGGACCTGGGCCACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986364504 Original CRISPR GCTGCACGAGGTGGTCCCTT AGG (reversed) Intergenic
No off target data available for this crispr