ID: 986364505

View in Genome Browser
Species Human (GRCh38)
Location 5:7017155-7017177
Sequence TGGCAGCTCGCTGCACGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986364505_986364510 3 Left 986364505 5:7017155-7017177 CCACCTCGTGCAGCGAGCTGCCA No data
Right 986364510 5:7017181-7017203 ATCTGGCTGTGTTGTCACATTGG No data
986364505_986364511 9 Left 986364505 5:7017155-7017177 CCACCTCGTGCAGCGAGCTGCCA No data
Right 986364511 5:7017187-7017209 CTGTGTTGTCACATTGGACCTGG No data
986364505_986364513 17 Left 986364505 5:7017155-7017177 CCACCTCGTGCAGCGAGCTGCCA No data
Right 986364513 5:7017195-7017217 TCACATTGGACCTGGGCCACTGG No data
986364505_986364514 20 Left 986364505 5:7017155-7017177 CCACCTCGTGCAGCGAGCTGCCA No data
Right 986364514 5:7017198-7017220 CATTGGACCTGGGCCACTGGAGG No data
986364505_986364517 30 Left 986364505 5:7017155-7017177 CCACCTCGTGCAGCGAGCTGCCA No data
Right 986364517 5:7017208-7017230 GGGCCACTGGAGGGTTTCCGTGG No data
986364505_986364512 10 Left 986364505 5:7017155-7017177 CCACCTCGTGCAGCGAGCTGCCA No data
Right 986364512 5:7017188-7017210 TGTGTTGTCACATTGGACCTGGG No data
986364505_986364515 21 Left 986364505 5:7017155-7017177 CCACCTCGTGCAGCGAGCTGCCA No data
Right 986364515 5:7017199-7017221 ATTGGACCTGGGCCACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986364505 Original CRISPR TGGCAGCTCGCTGCACGAGG TGG (reversed) Intergenic
No off target data available for this crispr