ID: 986364506

View in Genome Browser
Species Human (GRCh38)
Location 5:7017158-7017180
Sequence GGCTGGCAGCTCGCTGCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986364506_986364515 18 Left 986364506 5:7017158-7017180 CCTCGTGCAGCGAGCTGCCAGCC No data
Right 986364515 5:7017199-7017221 ATTGGACCTGGGCCACTGGAGGG No data
986364506_986364517 27 Left 986364506 5:7017158-7017180 CCTCGTGCAGCGAGCTGCCAGCC No data
Right 986364517 5:7017208-7017230 GGGCCACTGGAGGGTTTCCGTGG No data
986364506_986364511 6 Left 986364506 5:7017158-7017180 CCTCGTGCAGCGAGCTGCCAGCC No data
Right 986364511 5:7017187-7017209 CTGTGTTGTCACATTGGACCTGG No data
986364506_986364510 0 Left 986364506 5:7017158-7017180 CCTCGTGCAGCGAGCTGCCAGCC No data
Right 986364510 5:7017181-7017203 ATCTGGCTGTGTTGTCACATTGG No data
986364506_986364512 7 Left 986364506 5:7017158-7017180 CCTCGTGCAGCGAGCTGCCAGCC No data
Right 986364512 5:7017188-7017210 TGTGTTGTCACATTGGACCTGGG No data
986364506_986364513 14 Left 986364506 5:7017158-7017180 CCTCGTGCAGCGAGCTGCCAGCC No data
Right 986364513 5:7017195-7017217 TCACATTGGACCTGGGCCACTGG No data
986364506_986364514 17 Left 986364506 5:7017158-7017180 CCTCGTGCAGCGAGCTGCCAGCC No data
Right 986364514 5:7017198-7017220 CATTGGACCTGGGCCACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986364506 Original CRISPR GGCTGGCAGCTCGCTGCACG AGG (reversed) Intergenic
No off target data available for this crispr