ID: 986364507

View in Genome Browser
Species Human (GRCh38)
Location 5:7017164-7017186
Sequence GCAGCGAGCTGCCAGCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986364504_986364507 -5 Left 986364504 5:7017146-7017168 CCTAAGGGACCACCTCGTGCAGC No data
Right 986364507 5:7017164-7017186 GCAGCGAGCTGCCAGCCATCTGG No data
986364503_986364507 1 Left 986364503 5:7017140-7017162 CCAGGACCTAAGGGACCACCTCG No data
Right 986364507 5:7017164-7017186 GCAGCGAGCTGCCAGCCATCTGG No data
986364502_986364507 6 Left 986364502 5:7017135-7017157 CCTAGCCAGGACCTAAGGGACCA No data
Right 986364507 5:7017164-7017186 GCAGCGAGCTGCCAGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986364507 Original CRISPR GCAGCGAGCTGCCAGCCATC TGG Intergenic
No off target data available for this crispr