ID: 986364512

View in Genome Browser
Species Human (GRCh38)
Location 5:7017188-7017210
Sequence TGTGTTGTCACATTGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986364503_986364512 25 Left 986364503 5:7017140-7017162 CCAGGACCTAAGGGACCACCTCG No data
Right 986364512 5:7017188-7017210 TGTGTTGTCACATTGGACCTGGG No data
986364508_986364512 -10 Left 986364508 5:7017175-7017197 CCAGCCATCTGGCTGTGTTGTCA No data
Right 986364512 5:7017188-7017210 TGTGTTGTCACATTGGACCTGGG No data
986364504_986364512 19 Left 986364504 5:7017146-7017168 CCTAAGGGACCACCTCGTGCAGC No data
Right 986364512 5:7017188-7017210 TGTGTTGTCACATTGGACCTGGG No data
986364506_986364512 7 Left 986364506 5:7017158-7017180 CCTCGTGCAGCGAGCTGCCAGCC No data
Right 986364512 5:7017188-7017210 TGTGTTGTCACATTGGACCTGGG No data
986364505_986364512 10 Left 986364505 5:7017155-7017177 CCACCTCGTGCAGCGAGCTGCCA No data
Right 986364512 5:7017188-7017210 TGTGTTGTCACATTGGACCTGGG No data
986364502_986364512 30 Left 986364502 5:7017135-7017157 CCTAGCCAGGACCTAAGGGACCA No data
Right 986364512 5:7017188-7017210 TGTGTTGTCACATTGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986364512 Original CRISPR TGTGTTGTCACATTGGACCT GGG Intergenic
No off target data available for this crispr