ID: 986365320

View in Genome Browser
Species Human (GRCh38)
Location 5:7023052-7023074
Sequence GAAGGGAGACAGTTTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986365320 Original CRISPR GAAGGGAGACAGTTTTCCCC TGG Intergenic