ID: 986369859

View in Genome Browser
Species Human (GRCh38)
Location 5:7069091-7069113
Sequence TCGGTGAGGCAGGAGAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986369859_986369864 5 Left 986369859 5:7069091-7069113 CCACTGTTCTCCTGCCTCACCGA No data
Right 986369864 5:7069119-7069141 GTGAATGGCTTTTATCAATGCGG No data
986369859_986369865 19 Left 986369859 5:7069091-7069113 CCACTGTTCTCCTGCCTCACCGA No data
Right 986369865 5:7069133-7069155 TCAATGCGGATTTCTAACAGTGG No data
986369859_986369861 -10 Left 986369859 5:7069091-7069113 CCACTGTTCTCCTGCCTCACCGA No data
Right 986369861 5:7069104-7069126 GCCTCACCGACGTTAGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986369859 Original CRISPR TCGGTGAGGCAGGAGAACAG TGG (reversed) Intergenic
No off target data available for this crispr